Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp07

Orthogroup ID

OG0002087

Physical Location & Seq

Genomic Coordinates Forward (+)

19004341 .. 19008620

Gene Structure 4280 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.7G205700.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 891 bp

ATGGGAAATCCAAAGCAAAAATGGACATCGGAGGAGGAAGAAGCTCTAAGAGCTGGCGTGAAAAAGCATGGCACTGGCAAGTGGAAGGACATCCAGAAAGACCCTGAGTTCAATCCTTTCCTCTCTTCTCGCTCCAATATTGATCTCAAGGACAAATGGAGGAATATGACTGTTAGTGGCATGAACCCCAGAGATAAGTCAAGGGCGCCAAAAGCAAAAGCCAACGCCGATGCTCCTGCTGCTTCACTGTCCGTTTCACAAACTTCTGCTGCTGCTGCAGCCAAACGAGATGCACCAGCAGCAGCTACAGCTACAGCCAGACGCGATGCACCAGCAGCAACTCCAGCCAGACGCGATGCACCAGCAGCAACTCCAGCCAGACGCGATGCACCAGCAGCAACTCCAGTCAGGCACGATGCACCAGCAGCTCCAGTTGCAGATGATTCCTCAACTGGCTTATCTGATGCAAAAACTGCTCCAGCGTATGATGCAATGATTTTTGAAGCACTTTCTACCTCAACAGGGCCAAATGGATTGGACTCTGGTGCTATTGCTAGCTTTATTGAGCAAAGGAATGAAATCCCCCCAAATTTTAGAAGGTCATTAAGTAATAGGTTGAGAAGGCTGGTTCACCAAGAGAAACTTGAAAAGATTCAAAATTGCTACAGGACGAAAGCCCCGAAACAAAAGGACATCCATCCGATAGAGGAATCGGCAGTGGCTGCTGCCTACAAGATTGCTGATGCCGAAAACAAATCGTTTGTGGCAGCAGAAGCAGTGAAAGAGTTTGAGAGGTTGTCAGAGATGGCTGAAGAAGCAGAATCAACGCTGCAGGTGGCAGCAGAGATTCTTGAGAAATGTTCAGAAGGTGAAGTTCTGCTGATGGCATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005694 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0044424 GO:0044464

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Linker_histone Myb_DNA-bind_6 Myb_DNA-binding

Protein Analysis

297

Amino Acids

31.84

Weight (kDa)

8.41

Isoelectric Point (pI)

59.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002087)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G17520 AT1G17520 AT1G17520 AT1G17520 AT1G72740 AT1G72740
fragaria_vesca	FvH4_1g07940 FvH4_1g07940 FvH4_6g34130
malus_domestica	MD02G1083400.v1.1 MD09G1188600.v1.1 MD15G1211100.v1.1
prunus_persica	Prupe.3G045300_v2.0.a1 Prupe.3G045300_v2.0.a1 Prupe.3G045300_v2.0.a1 Prupe.3G045300_v2.0.a1 Prupe.3G045300_v2.0.a1 Prupe.7G205700_v2.0.a1 Prupe.7G205700_v2.0.a1 Prupe.7G205700_v2.0.a1
pyrus_communis	pycom02g06590 pycom09g10570 pycom15g18710
rosa_chinensis	RchiOBHm_Chr2g0093821 RchiOBHm_Chr2g0144441
rosa_laevigata	RLG00000016439 RLG00000020081
rosa_multiflora	Rmu_co8254463.1_g000001 Rmu_sc0002126.1_g000001 Rmu_sc0003027.1_g000017 Rmu_sc0017523.1_g000002
rosa_roxburghii	Rroxscaffold_2G00101310 Rroxscaffold_2G00147780
rosa_rugosa	Rorug02G0040100 Rorug02G0386600
rosa_samantha	Rh2AG086500 Rh2AG438900 Rh2BG087000 Rh2BG449200 Rh2CG089400 Rh2CG425900 Rh2DG085000 Rh2DG458900
rosa_wichuraiana	Rw2G035910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	823
Acc36I	ACCTGC	1 cut(s)	823
AccB1I	GGYRCC	1 cut(s)	205
AccII	CGCG	3 cut(s)	324, 354, 384
AcsI	RAATTY	1 cut(s)	589
AcuI	CTGAAG	1 cut(s)	831
AcyI	GRCGYC	1 cut(s)	206
AfiI	CCNNNNNNNGG	1 cut(s)	522
AgsI	TTSAA	4 cut(s)	112, 503, 647, 656
AluBI	AGCT	6 cut(s)	44, 53, 305, 311, 428, 558
AluI	AGCT	6 cut(s)	44, 53, 305, 311, 428, 558
AlwNI	CAGNNNCTG	1 cut(s)	722
AoxI	GGCC	1 cut(s)	524
ApoI	RAATTY	1 cut(s)	589
Asp700I	GAANNNNTTC	1 cut(s)	651
AspLEI	GCGC	1 cut(s)	208
AspS9I	GGNCC	1 cut(s)	524
AsuHPI	GGTGA	2 cut(s)	623, 881
AsuNHI	GCTAGC	1 cut(s)	554
BanI	GGYRCC	1 cut(s)	205
BccI	CCATC	3 cut(s)	705, 799, 877
BcgI	CGANNNNNNTGC	2 cut(s)	218, 252
BfaI	CTAG	1 cut(s)	555
BfmI	CTRYAG	5 cut(s)	276, 306, 312, 664, 830
BfoI	RGCGCY	1 cut(s)	209
BfuAI	ACCTGC	1 cut(s)	823
BmgT120I	GGNCC	1 cut(s)	524
BmiI	GGNNCC	1 cut(s)	207
BmsI	GCATC	9 cut(s)	220, 280, 316, 346, 376, 406, 454, 478, 733
BmtI	GCTAGC	1 cut(s)	558
BpmI	CTGGAG	5 cut(s)	327, 357, 387, 414, 462
BpuEI	CTTGAG	2 cut(s)	131, 872
BsaHI	GRCGYC	1 cut(s)	206
Bsc4I	CCNNNNNNNGG	1 cut(s)	522
Bse1I	ACTGG	4 cut(s)	79, 404, 431, 457
Bse3DI	GCAATG	1 cut(s)	498
BseGI	GGATG	3 cut(s)	90, 693, 697
BseLI	CCNNNNNNNGG	1 cut(s)	522
BseMI	GCAATG	1 cut(s)	498
BseMII	CTCAG	1 cut(s)	96
BseNI	ACTGG	4 cut(s)	79, 404, 431, 457
BseRI	GAGGAG	1 cut(s)	47
Bsh1236I	CGCG	3 cut(s)	324, 354, 384
BshFI	GGCC	1 cut(s)	526
BshNI	GGYRCC	1 cut(s)	205
BslI	CCNNNNNNNGG	1 cut(s)	522
BsnI	GGCC	1 cut(s)	526
Bsp143I	GATC	1 cut(s)	142
BspANI	GGCC	1 cut(s)	526
BspCNI	CTCAG	1 cut(s)	97
BspFNI	CGCG	3 cut(s)	324, 354, 384
BspLI	GGNNCC	1 cut(s)	207
BspMAI	CTGCAG	2 cut(s)	280, 834
BspMI	ACCTGC	1 cut(s)	823
BspOI	GCTAGC	1 cut(s)	558
BspT107I	GGYRCC	1 cut(s)	205
BsrDI	GCAATG	1 cut(s)	498
BsrI	ACTGG	4 cut(s)	79, 404, 431, 457
BssMI	GATC	1 cut(s)	142
BssNI	GRCGYC	1 cut(s)	206
Bst4CI	ACNGT	2 cut(s)	172, 249
Bst6I	CTCTTC	1 cut(s)	130
BstACI	GRCGYC	1 cut(s)	206
BstAPI	GCANNNNNTGC	2 cut(s)	473, 722
BstC8I	GCNNGC	2 cut(s)	55, 556
BstDEI	CTNAG	2 cut(s)	47, 105
BstF5I	GGATG	3 cut(s)	90, 693, 697
BstFNI	CGCG	3 cut(s)	324, 354, 384
BstH2I	RGCGCY	1 cut(s)	209
BstHHI	GCGC	1 cut(s)	208
BstKTI	GATC	1 cut(s)	145
BstMBI	GATC	1 cut(s)	142
BstSFI	CTRYAG	5 cut(s)	276, 306, 312, 664, 830
BstUI	CGCG	3 cut(s)	324, 354, 384
BsuRI	GGCC	1 cut(s)	526
BtgZI	GCGATG	3 cut(s)	339, 369, 399
BtsCI	GGATG	3 cut(s)	90, 693, 697
BtsI	GCAGTG	2 cut(s)	723, 783
BtsIMutI	CAGTG	4 cut(s)	72, 245, 723, 783
BveI	ACCTGC	1 cut(s)	823
Cac8I	GCNNGC	2 cut(s)	55, 556
CaiI	CAGNNNCTG	1 cut(s)	722
CfoI	GCGC	1 cut(s)	208
Cfr13I	GGNCC	1 cut(s)	524
CseI	GACGC	3 cut(s)	330, 360, 390
CviAII	CATG	3 cut(s)	68, 181, 888
DdeI	CTNAG	2 cut(s)	47, 105
DinI	GGCGCC	1 cut(s)	207
DpnI	GATC	1 cut(s)	144
DpnII	GATC	1 cut(s)	142
Eam1104I	CTCTTC	1 cut(s)	130
EarI	CTCTTC	1 cut(s)	130
Eco57I	CTGAAG	1 cut(s)	831
EgeI	GGCGCC	1 cut(s)	207
EheI	GGCGCC	1 cut(s)	207
FaeI	CATG	3 cut(s)	71, 184, 891
FaiI	YATR	5 cut(s)	69, 167, 182, 486, 889
FalI	AAGNNNNNCTT	2 cut(s)	627, 659
FatI	CATG	3 cut(s)	67, 180, 887
FokI	GGATG	3 cut(s)	77, 680, 684
FspBI	CTAG	1 cut(s)	555
GlaI	GCGC	1 cut(s)	207
GsuI	CTGGAG	5 cut(s)	327, 357, 387, 414, 462
HaeII	RGCGCY	1 cut(s)	209
HaeIII	GGCC	1 cut(s)	526
HgaI	GACGC	3 cut(s)	330, 360, 390
HhaI	GCGC	1 cut(s)	208
Hin1I	GRCGYC	1 cut(s)	206
Hin1II	CATG	3 cut(s)	71, 184, 891
Hin6I	GCGC	1 cut(s)	206
HinP1I	GCGC	1 cut(s)	206
HinfI	GANTC	6 cut(s)	443, 539, 652, 710, 821, 847
HphI	GGTGA	2 cut(s)	623, 881
Hpy166II	GTNNAC	1 cut(s)	631
Hpy188I	TCNGA	5 cut(s)	31, 463, 702, 802, 865
Hpy188III	TCNNGA	2 cut(s)	94, 851
Hpy8I	GTNNAC	1 cut(s)	631
HpyAV	CCTTC	4 cut(s)	79, 591, 615, 860
HpyCH4III	ACNGT	2 cut(s)	172, 249
HpyF3I	CTNAG	2 cut(s)	47, 105
Hsp92I	GRCGYC	1 cut(s)	206
Hsp92II	CATG	3 cut(s)	71, 184, 891
HspAI	GCGC	1 cut(s)	206
KasI	GGCGCC	1 cut(s)	205
Kzo9I	GATC	1 cut(s)	142
LmnI	GCTCC	4 cut(s)	137, 238, 433, 481
LweI	GCATC	9 cut(s)	220, 280, 316, 346, 376, 406, 454, 478, 733
MaeI	CTAG	1 cut(s)	555
MalI	GATC	1 cut(s)	144
MboI	GATC	1 cut(s)	142
MboII	GAAGA	3 cut(s)	50, 117, 824
MluCI	AATT	2 cut(s)	589, 658
Mly113I	GGCGCC	1 cut(s)	206
MlyI	GAGTC	1 cut(s)	533
MnlI	CCTC	8 cut(s)	25, 28, 131, 153, 457, 526, 700, 786
MroXI	GAANNNNTTC	1 cut(s)	651
MseI	TTAA	1 cut(s)	605
MvnI	CGCG	3 cut(s)	324, 354, 384
NarI	GGCGCC	1 cut(s)	206
NdeII	GATC	1 cut(s)	142
NheI	GCTAGC	1 cut(s)	554
NlaIII	CATG	3 cut(s)	71, 184, 891
NlaIV	GGNNCC	1 cut(s)	207
PaqCI	CACCTGC	1 cut(s)	823
PcsI	WCGNNNNNNNCGW	1 cut(s)	677
PdmI	GAANNNNTTC	1 cut(s)	651
PfeI	GAWTC	5 cut(s)	443, 652, 710, 821, 847
PleI	GAGTC	1 cut(s)	533
PluTI	GGCGCC	1 cut(s)	209
PpsI	GAGTC	1 cut(s)	533
PspN4I	GGNNCC	1 cut(s)	207
PspPI	GGNCC	1 cut(s)	524
PstI	CTGCAG	2 cut(s)	280, 834
PstNI	CAGNNNCTG	1 cut(s)	722
SaqAI	TTAA	1 cut(s)	605
Sau3AI	GATC	1 cut(s)	142
Sau96I	GGNCC	1 cut(s)	524
SchI	GAGTC	1 cut(s)	533
SfaNI	GCATC	9 cut(s)	220, 280, 316, 346, 376, 406, 454, 478, 733
SfcI	CTRYAG	5 cut(s)	276, 306, 312, 664, 830
SfoI	GGCGCC	1 cut(s)	207
SmlI	CTYRAG	2 cut(s)	146, 851
SmoI	CTYRAG	2 cut(s)	146, 851
Sse9I	AATT	2 cut(s)	589, 658
SspDI	GGCGCC	1 cut(s)	205
SspI	AATATT	1 cut(s)	139
SspMI	CTAG	1 cut(s)	555
TaaI	ACNGT	2 cut(s)	172, 249
TasI	AATT	2 cut(s)	589, 658
TfiI	GAWTC	5 cut(s)	443, 652, 710, 821, 847
Tru1I	TTAA	1 cut(s)	605
Tru9I	TTAA	1 cut(s)	605
TscAI	CASTG	4 cut(s)	79, 252, 723, 783
TspDTI	ATGAA	2 cut(s)	197, 591
TspGWI	ACGGA	1 cut(s)	241
TspRI	CASTG	4 cut(s)	79, 252, 723, 783
XapI	RAATTY	1 cut(s)	589
XcmI	CCANNNNNNNNNTGG	1 cut(s)	18
XmnI	GAANNNNTTC	1 cut(s)	651
XspI	CTAG	1 cut(s)	555

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.