pycom05g09720

beta-glucosidase activity

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr5
Physical Location & Seq
Reverse (-)
12950904 .. 12951326
423 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom05g09720.2

Sequence Viewer

Length: 240 bp
ATGAAATATTCACGATCTTTGCTCTTTGGTGTGCTGCTACTCATTGGCTTTGCATTGACAAATAGCAAAGCAACTCATACAGATCCACCTGTTCATTGCGAATTTCTCAATCGCAGCAGTTTTGAACCAGGGTTTATATTTGGCACAGGTTCCGCAGCTTACCAGGAAGGTGCAGTAAAAGAAGATGGAAGAGGCCCAAGCATATGGGATACCTTCACCCACAAACATCCAGGTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

8.66

Weight (kDa)

6.9

Isoelectric Point (pI)

35.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 153
AclWI GGATC 1 cut(s) 77
AcsI RAATTY 1 cut(s) 101
AgsI TTSAA 1 cut(s) 125
AjnI CCWGG 3 cut(s) 127, 162, 229
AluBI AGCT 1 cut(s) 158
AluI AGCT 1 cut(s) 158
AlwI GGATC 1 cut(s) 77
AoxI GGCC 1 cut(s) 193
ApeKI GCWGC 3 cut(s) 34, 114, 155
ApoI RAATTY 1 cut(s) 101
AspS9I GGNCC 1 cut(s) 194
AsuHPI GGTGA 1 cut(s) 208
BbvI GCAGC 3 cut(s) 21, 126, 167
BccI CCATC 1 cut(s) 179
BciT130I CCWGG 3 cut(s) 129, 164, 231
BciVI GTATCC 1 cut(s) 202
BfuI GTATCC 1 cut(s) 202
BisI GCNGC 3 cut(s) 35, 115, 156
BlsI GCNGC 3 cut(s) 36, 116, 157
Bme1390I CCNGG 3 cut(s) 129, 164, 231
BmgT120I GGNCC 1 cut(s) 194
BmiI GGNNCC 1 cut(s) 151
BmrFI CCNGG 3 cut(s) 129, 164, 231
BsaJI CCNNGG 1 cut(s) 128
Bse3DI GCAATG 1 cut(s) 94
BseBI CCWGG 3 cut(s) 129, 164, 231
BseDI CCNNGG 1 cut(s) 128
BseGI GGATG 1 cut(s) 226
BseMI GCAATG 1 cut(s) 94
BseXI GCAGC 3 cut(s) 21, 126, 167
BsgI GTGCAG 1 cut(s) 192
BshFI GGCC 1 cut(s) 195
BsnI GGCC 1 cut(s) 195
Bsp143I GATC 2 cut(s) 14, 82
BspACI CCGC 1 cut(s) 153
BspANI GGCC 1 cut(s) 195
BspLI GGNNCC 1 cut(s) 151
BspPI GGATC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 128
BssMI GATC 2 cut(s) 14, 82
Bst2UI CCWGG 3 cut(s) 129, 164, 231
Bst6I CTCTTC 1 cut(s) 184
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 2 cut(s) 17, 85
BstMBI GATC 2 cut(s) 14, 82
BstNI CCWGG 3 cut(s) 129, 164, 231
BstSCI CCNGG 3 cut(s) 127, 162, 229
BstV1I GCAGC 3 cut(s) 21, 126, 167
BstX2I RGATCY 1 cut(s) 82
BstXI CCANNNNNNTGG 1 cut(s) 204
BstYI RGATCY 1 cut(s) 82
BsuI GTATCC 1 cut(s) 202
BsuRI GGCC 1 cut(s) 195
BtsCI GGATG 1 cut(s) 226
Cfr13I GGNCC 1 cut(s) 194
CviJI RGCY 3 cut(s) 48, 158, 195
CviKI_1 RGCY 3 cut(s) 48, 158, 195
DpnI GATC 2 cut(s) 16, 84
DpnII GATC 2 cut(s) 14, 82
Eam1104I CTCTTC 1 cut(s) 184
EarI CTCTTC 1 cut(s) 184
EcoRII CCWGG 3 cut(s) 127, 162, 229
FaiI YATR 4 cut(s) 78, 137, 203, 205
FauNDI CATATG 1 cut(s) 203
Fnu4HI GCNGC 3 cut(s) 35, 115, 156
FokI GGATG 1 cut(s) 213
Fsp4HI GCNGC 3 cut(s) 35, 115, 156
GluI GCNGC 3 cut(s) 35, 115, 156
HaeIII GGCC 1 cut(s) 195
HphI GGTGA 1 cut(s) 208
Hpy188III TCNNGA 1 cut(s) 12
HpyAV CCTTC 2 cut(s) 161, 223
HpyCH4V TGCA 2 cut(s) 53, 173
Kzo9I GATC 2 cut(s) 14, 82
LpnPI CCDG 7 cut(s) 102, 114, 132, 141, 149, 176, 216
Lsp1109I GCAGC 3 cut(s) 21, 126, 167
MalI GATC 2 cut(s) 16, 84
MboI GATC 2 cut(s) 14, 82
MboII GAAGA 2 cut(s) 194, 201
MflI RGATCY 1 cut(s) 82
MluCI AATT 1 cut(s) 101
MnlI CCTC 1 cut(s) 185
MspR9I CCNGG 3 cut(s) 129, 164, 231
MvaI CCWGG 3 cut(s) 129, 164, 231
NdeI CATATG 1 cut(s) 203
NdeII GATC 2 cut(s) 14, 82
NlaIV GGNNCC 1 cut(s) 151
PkrI GCNGC 3 cut(s) 36, 116, 157
Psp6I CCWGG 3 cut(s) 127, 162, 229
PspGI CCWGG 3 cut(s) 127, 162, 229
PspN4I GGNNCC 1 cut(s) 151
PspPI GGNCC 1 cut(s) 194
PsuI RGATCY 1 cut(s) 82
SatI GCNGC 3 cut(s) 35, 115, 156
Sau3AI GATC 2 cut(s) 14, 82
Sau96I GGNCC 1 cut(s) 194
ScrFI CCNGG 3 cut(s) 129, 164, 231
SetI ASST 6 cut(s) 91, 151, 160, 172, 215, 235
SgeI CNNG 8 cut(s) 24, 101, 140, 141, 159, 175, 176, 210
Sse9I AATT 1 cut(s) 101
SsiI CCGC 1 cut(s) 153
SspI AATATT 1 cut(s) 8
StyD4I CCNGG 3 cut(s) 127, 162, 229
TasI AATT 1 cut(s) 101
TseI GCWGC 3 cut(s) 34, 114, 155
TspDTI ATGAA 2 cut(s) 17, 83
XapI RAATTY 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.