pycom10g07300

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Forward (+)
8560859 .. 8561428
570 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g07300.1

Sequence Viewer

Length: 570 bp
ATGGAGCAGCTGCAACCACCACCCATGGCAGTGACGCAGCAAGCCTACACTACCCATTCGGGTCACGGGTCGGTGGGACCCGTTATTGCAGTGGTTGCAGTGATCACCATTCTCGGAGTCATTGCGGTCATGATTGGTAGGCTCTGCTCCGGTCATCGGATCATGGGTCATGGGCGACACTACAACTTCGAATCATGGGTGGAGACAAAATGTTCTTCGTGTCTTGACGGCAGAATCGACCCTTCTCCACCGCCTCCACCACCGGTCACTGTCTCCGGCGAGGATGTCGCCCTGGCAGAGAGGGCAGACGCATCGCAAGAAATAAAGGAAGAAGAAGGAGAAAAAGAAGAACCCCAACAACATCAGCAGCAGCAACATCAACAACAACATCCTCCGCAGCAGGAACAACATCCACGACAACATCAGCAGCGGCAACAACATCAACAGCAACATCAACAACAACATCCTCCGCAGCAGGAACAACATCGACGACAACATCAGCAGCGGCAACAACATCAACAGCAACAGCAACAACACAATTCCCAAGCAGCAAGTAGTAGTGAGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

190

Amino Acids

21.47

Weight (kDa)

6.25

Isoelectric Point (pI)

83.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 6 cut(s) 125, 251, 395, 430, 470, 505
AclWI GGATC 1 cut(s) 167
AfiI CCNNNNNNNGG 1 cut(s) 156
AgeI ACCGGT 1 cut(s) 262
AjnI CCWGG 1 cut(s) 291
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
Alw26I GTCTC 2 cut(s) 197, 277
AlwI GGATC 1 cut(s) 167
AsiGI ACCGGT 1 cut(s) 262
AspS9I GGNCC 1 cut(s) 77
AsuHPI GGTGA 1 cut(s) 97
AsuII TTCGAA 1 cut(s) 189
AvaII GGWCC 1 cut(s) 77
BbvI GCAGC 9 cut(s) 19, 49, 379, 382, 409, 439, 484, 514, 560
BceAI ACGGC 1 cut(s) 244
BcgI CGANNNNNNTGC 2 cut(s) 294, 328
BciT130I CCWGG 1 cut(s) 293
BclI TGATCA 1 cut(s) 102
BcoDI GTCTC 2 cut(s) 197, 277
Bme1390I CCNGG 1 cut(s) 293
Bme18I GGWCC 1 cut(s) 77
BmgT120I GGNCC 1 cut(s) 77
BmiI GGNNCC 2 cut(s) 78, 79
BmrFI CCNGG 1 cut(s) 293
BmsI GCATC 1 cut(s) 320
Bpu14I TTCGAA 1 cut(s) 189
BsaJI CCNNGG 2 cut(s) 24, 291
BsaWI WCCGGW 2 cut(s) 149, 262
Bsc4I CCNNNNNNNGG 1 cut(s) 156
Bse118I RCCGGY 1 cut(s) 262
Bse3DI GCAATG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 293
BseDI CCNNGG 2 cut(s) 24, 291
BseGI GGATG 4 cut(s) 289, 388, 409, 463
BseLI CCNNNNNNNGG 1 cut(s) 156
BseMI GCAATG 1 cut(s) 120
BseXI GCAGC 9 cut(s) 19, 49, 379, 382, 409, 439, 484, 514, 560
BshTI ACCGGT 1 cut(s) 262
BsiSI CCGG 3 cut(s) 150, 263, 276
BslFI GGGAC 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 156
BsmAI GTCTC 2 cut(s) 197, 277
BsmFI GGGAC 1 cut(s) 90
Bsp119I TTCGAA 1 cut(s) 189
Bsp143I GATC 2 cut(s) 102, 159
Bsp19I CCATGG 1 cut(s) 24
BspACI CCGC 6 cut(s) 125, 251, 395, 430, 470, 505
BspHI TCATGA 1 cut(s) 129
BspLI GGNNCC 2 cut(s) 78, 79
BspPI GGATC 1 cut(s) 167
BspT104I TTCGAA 1 cut(s) 189
BsrDI GCAATG 1 cut(s) 120
BsrFI RCCGGY 1 cut(s) 262
BssAI RCCGGY 1 cut(s) 262
BssECI CCNNGG 2 cut(s) 24, 291
BssMI GATC 2 cut(s) 102, 159
BssT1I CCWWGG 1 cut(s) 24
Bst2UI CCWGG 1 cut(s) 293
Bst4CI ACNGT 1 cut(s) 271
BstAPI GCANNNNNTGC 1 cut(s) 95
BstBI TTCGAA 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 42
BstDSI CCRYGG 1 cut(s) 24
BstF5I GGATG 4 cut(s) 289, 388, 409, 463
BstKTI GATC 2 cut(s) 105, 162
BstMAI GTCTC 2 cut(s) 197, 277
BstMBI GATC 2 cut(s) 102, 159
BstMWI GCNNNNNNNGC 2 cut(s) 95, 302
BstNI CCWGG 1 cut(s) 293
BstSCI CCNGG 1 cut(s) 291
BstV1I GCAGC 9 cut(s) 19, 49, 379, 382, 409, 439, 484, 514, 560
BtgI CCRYGG 1 cut(s) 24
BtgZI GCGATG 1 cut(s) 297
BtsCI GGATG 4 cut(s) 289, 388, 409, 463
BtsI GCAGTG 3 cut(s) 36, 96, 105
BtsIMutI CAGTG 4 cut(s) 36, 96, 105, 267
Cac8I GCNNGC 1 cut(s) 42
CciI TCATGA 1 cut(s) 129
Cfr10I RCCGGY 1 cut(s) 262
Cfr13I GGNCC 1 cut(s) 77
CseI GACGC 2 cut(s) 43, 317
CspAI ACCGGT 1 cut(s) 262
CviAII CATG 5 cut(s) 25, 130, 163, 170, 195
CviJI RGCY 3 cut(s) 10, 44, 142
CviKI_1 RGCY 3 cut(s) 10, 44, 142
DpnI GATC 2 cut(s) 104, 161
DpnII GATC 2 cut(s) 102, 159
Eco130I CCWWGG 1 cut(s) 24
Eco47I GGWCC 1 cut(s) 77
EcoO109I RGGNCCY 1 cut(s) 77
EcoRII CCWGG 1 cut(s) 291
EcoT14I CCWWGG 1 cut(s) 24
ErhI CCWWGG 1 cut(s) 24
FaeI CATG 5 cut(s) 28, 133, 166, 173, 198
FaiI YATR 6 cut(s) 26, 131, 164, 171, 196, 568
FaqI GGGAC 1 cut(s) 90
FatI CATG 5 cut(s) 24, 129, 162, 169, 194
FbaI TGATCA 1 cut(s) 102
FokI GGATG 4 cut(s) 296, 375, 396, 450
HapII CCGG 3 cut(s) 150, 263, 276
HgaI GACGC 2 cut(s) 43, 317
Hin1II CATG 5 cut(s) 28, 133, 166, 173, 198
HinfI GANTC 4 cut(s) 117, 191, 234, 563
HpaII CCGG 3 cut(s) 150, 263, 276
HphI GGTGA 1 cut(s) 97
Hpy188I TCNGA 2 cut(s) 116, 159
Hpy188III TCNNGA 2 cut(s) 130, 224
Hpy99I CGWCG 1 cut(s) 492
HpyAV CCTTC 2 cut(s) 252, 329
HpyCH4III ACNGT 1 cut(s) 271
HpyCH4V TGCA 3 cut(s) 13, 89, 98
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 302
Hsp92II CATG 5 cut(s) 28, 133, 166, 173, 198
KflI GGGWCCC 1 cut(s) 77
Ksp22I TGATCA 1 cut(s) 102
Kzo9I GATC 2 cut(s) 102, 159
LmnI GCTCC 2 cut(s) 4, 152
LpnPI CCDG 7 cut(s) 163, 276, 278, 289, 305, 386, 461
Lsp1109I GCAGC 9 cut(s) 19, 49, 379, 382, 409, 439, 484, 514, 560
LweI GCATC 1 cut(s) 320
MaeIII GTNAC 3 cut(s) 31, 62, 265
MalI GATC 2 cut(s) 104, 161
MboI GATC 2 cut(s) 102, 159
MboII GAAGA 4 cut(s) 207, 341, 344, 359
MluCI AATT 1 cut(s) 538
MlyI GAGTC 1 cut(s) 126
MnlI CCTC 5 cut(s) 264, 274, 294, 402, 477
MslI CAYNNNNRTG 1 cut(s) 29
MspA1I CMGCKG 3 cut(s) 10, 430, 505
MspI CCGG 3 cut(s) 150, 263, 276
MspR9I CCNGG 1 cut(s) 293
MvaI CCWGG 1 cut(s) 293
MwoI GCNNNNNNNGC 2 cut(s) 95, 302
NcoI CCATGG 1 cut(s) 24
NdeII GATC 2 cut(s) 102, 159
NlaIII CATG 5 cut(s) 28, 133, 166, 173, 198
NlaIV GGNNCC 2 cut(s) 78, 79
NmuCI GTSAC 3 cut(s) 31, 62, 265
NspV TTCGAA 1 cut(s) 189
PagI TCATGA 1 cut(s) 129
PcsI WCGNNNNNNNCGW 1 cut(s) 234
PfeI GAWTC 2 cut(s) 191, 234
PinAI ACCGGT 1 cut(s) 262
PleI GAGTC 1 cut(s) 125
PpsI GAGTC 1 cut(s) 125
PpuMI RGGWCCY 1 cut(s) 77
Psp5II RGGWCCY 1 cut(s) 77
Psp6I CCWGG 1 cut(s) 291
PspGI CCWGG 1 cut(s) 291
PspN4I GGNNCC 2 cut(s) 78, 79
PspPI GGNCC 1 cut(s) 77
PspPPI RGGWCCY 1 cut(s) 77
PvuII CAGCTG 1 cut(s) 10
RseI CAYNNNNRTG 1 cut(s) 29
Sau3AI GATC 2 cut(s) 102, 159
Sau96I GGNCC 1 cut(s) 77
SchI GAGTC 1 cut(s) 126
ScrFI CCNGG 1 cut(s) 293
SetI ASST 1 cut(s) 12
SfaNI GCATC 1 cut(s) 320
SfuI TTCGAA 1 cut(s) 189
SinI GGWCC 1 cut(s) 77
SmiMI CAYNNNNRTG 1 cut(s) 29
Sse9I AATT 1 cut(s) 538
SsiI CCGC 6 cut(s) 125, 251, 395, 430, 470, 505
StyD4I CCNGG 1 cut(s) 291
StyI CCWWGG 1 cut(s) 24
TaaI ACNGT 1 cut(s) 271
TaqI TCGA 3 cut(s) 189, 237, 487
TasI AATT 1 cut(s) 538
TauI GCSGC 2 cut(s) 433, 508
TfiI GAWTC 2 cut(s) 191, 234
TscAI CASTG 4 cut(s) 36, 96, 105, 274
TseFI GTSAC 3 cut(s) 31, 62, 265
Tsp45I GTSAC 3 cut(s) 31, 62, 265
TspRI CASTG 4 cut(s) 36, 96, 105, 274
VpaK11BI GGWCC 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.