pycom10g14370

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
17762222 .. 17763064
843 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g14370.2

Sequence Viewer

Length: 411 bp
ATGAACAATGTGGCACGTCAGAGAAGAAAGAAACGCTTAAAGGGGACAGAACCAAACCCTGTCAAGAATGAAGGAGCTTCTGAGATGGGCTGCTGCTGCAAAATCAGACAAGGTGGAAACTACTTTCCTCGAAAGGTTATGCAATTTCAAAACCGGGCAACTCTGAAAGCGGTAGCATATGATGATCAACTAAGCAACGATTCACCGAAGATCAGCTTCAGATGGGATTTGGAGAGCTGCTCCACCACATCCTCTGCCTATACAGCACTTTCAACAGCATCTTCACTCAAGAATGATCAGATCATAAGCCTTCCATCTTTGAATTCGACAAAATTTCAACACCTGGATGACTTCGAGCCCAAGAAAGGGAACTGGATCACCTCAAACTCAGAATGTATAGTTTCTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

137

Amino Acids

15.23

Weight (kDa)

9.32

Isoelectric Point (pI)

41.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 170
AclWI GGATC 1 cut(s) 383
AcsI RAATTY 2 cut(s) 322, 332
AcuI CTGAAG 1 cut(s) 202
AfiI CCNNNNNNNGG 2 cut(s) 365, 366
AgsI TTSAA 4 cut(s) 149, 273, 322, 338
AjiI CACGTC 1 cut(s) 17
AjnI CCWGG 1 cut(s) 342
AluBI AGCT 3 cut(s) 77, 216, 237
AluI AGCT 3 cut(s) 77, 216, 237
AlwI GGATC 1 cut(s) 383
ApeKI GCWGC 4 cut(s) 90, 93, 96, 237
ApoI RAATTY 2 cut(s) 322, 332
AsuC2I CCSGG 1 cut(s) 155
AsuHPI GGTGA 2 cut(s) 195, 370
BanII GRGCYC 1 cut(s) 360
BbvI GCAGC 4 cut(s) 77, 80, 83, 224
BccI CCATC 3 cut(s) 79, 216, 322
BciT130I CCWGG 1 cut(s) 344
BclI TGATCA 2 cut(s) 184, 295
BcnI CCSGG 1 cut(s) 155
BisI GCNGC 4 cut(s) 91, 94, 97, 238
BlsI GCNGC 4 cut(s) 92, 95, 98, 239
Bme1390I CCNGG 2 cut(s) 155, 344
BmgBI CACGTC 1 cut(s) 17
BmrFI CCNGG 2 cut(s) 155, 344
BmsI GCATC 1 cut(s) 287
BplI GAGNNNNNCTC 2 cut(s) 224, 256
BpuEI CTTGAG 1 cut(s) 272
BpuMI CCSGG 1 cut(s) 155
Bsc4I CCNNNNNNNGG 2 cut(s) 365, 366
Bse1I ACTGG 1 cut(s) 377
BseBI CCWGG 1 cut(s) 344
BseGI GGATG 2 cut(s) 248, 352
BseLI CCNNNNNNNGG 2 cut(s) 365, 366
BseMII CTCAG 2 cut(s) 72, 402
BseNI ACTGG 1 cut(s) 377
BseXI GCAGC 4 cut(s) 77, 80, 83, 224
BsiSI CCGG 1 cut(s) 154
BslFI GGGAC 1 cut(s) 58
BslI CCNNNNNNNGG 2 cut(s) 365, 366
BsmFI GGGAC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 360
Bsp143I GATC 5 cut(s) 184, 210, 295, 300, 375
BspACI CCGC 1 cut(s) 170
BspCNI CTCAG 2 cut(s) 73, 401
BspPI GGATC 1 cut(s) 383
BsrI ACTGG 1 cut(s) 377
BssMI GATC 5 cut(s) 184, 210, 295, 300, 375
Bst2UI CCWGG 1 cut(s) 344
BstDEI CTNAG 3 cut(s) 81, 191, 388
BstF5I GGATG 2 cut(s) 248, 352
BstKTI GATC 5 cut(s) 187, 213, 298, 303, 378
BstMBI GATC 5 cut(s) 184, 210, 295, 300, 375
BstMWI GCNNNNNNNGC 2 cut(s) 96, 263
BstNI CCWGG 1 cut(s) 344
BstSCI CCNGG 2 cut(s) 153, 342
BstV1I GCAGC 4 cut(s) 77, 80, 83, 224
BtrI CACGTC 1 cut(s) 17
BtsCI GGATG 2 cut(s) 248, 352
CviJI RGCY 6 cut(s) 77, 90, 216, 237, 309, 358
CviKI_1 RGCY 6 cut(s) 77, 90, 216, 237, 309, 358
DdeI CTNAG 3 cut(s) 81, 191, 388
DpnI GATC 5 cut(s) 186, 212, 297, 302, 377
DpnII GATC 5 cut(s) 184, 210, 295, 300, 375
Eco24I GRGCYC 1 cut(s) 360
Eco57I CTGAAG 1 cut(s) 202
EcoRI GAATTC 1 cut(s) 322
EcoRII CCWGG 1 cut(s) 342
EcoT38I GRGCYC 1 cut(s) 360
FaiI YATR 6 cut(s) 140, 178, 180, 261, 305, 398
FalI AAGNNNNNCTT 4 cut(s) 20, 52, 200, 232
FaqI GGGAC 1 cut(s) 58
FauNDI CATATG 1 cut(s) 178
FbaI TGATCA 2 cut(s) 184, 295
Fnu4HI GCNGC 4 cut(s) 91, 94, 97, 238
FokI GGATG 2 cut(s) 235, 359
FriOI GRGCYC 1 cut(s) 360
Fsp4HI GCNGC 4 cut(s) 91, 94, 97, 238
GluI GCNGC 4 cut(s) 91, 94, 97, 238
HapII CCGG 1 cut(s) 154
HinfI GANTC 1 cut(s) 200
HpaII CCGG 1 cut(s) 154
HphI GGTGA 2 cut(s) 195, 370
Hpy188I TCNGA 7 cut(s) 21, 82, 107, 165, 221, 300, 391
Hpy188III TCNNGA 2 cut(s) 64, 289
HpyAV CCTTC 2 cut(s) 65, 320
HpyCH4IV ACGT 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 99, 142
HpyF10VI GCNNNNNNNGC 2 cut(s) 96, 263
HpyF3I CTNAG 3 cut(s) 81, 191, 388
HpySE526I ACGT 1 cut(s) 16
Ksp22I TGATCA 2 cut(s) 184, 295
Kzo9I GATC 5 cut(s) 184, 210, 295, 300, 375
LmnI GCTCC 2 cut(s) 74, 245
LpnPI CCDG 5 cut(s) 72, 167, 329, 356, 358
Lsp1109I GCAGC 4 cut(s) 77, 80, 83, 224
LweI GCATC 1 cut(s) 287
MaeII ACGT 1 cut(s) 16
MalI GATC 5 cut(s) 186, 212, 297, 302, 377
MboI GATC 5 cut(s) 184, 210, 295, 300, 375
MboII GAAGA 3 cut(s) 36, 220, 273
MhlI GDGCHC 1 cut(s) 360
MluCI AATT 3 cut(s) 143, 322, 332
MnlI CCTC 3 cut(s) 138, 262, 391
MseI TTAA 2 cut(s) 38, 409
MslI CAYNNNNRTG 1 cut(s) 345
MspI CCGG 1 cut(s) 154
MspR9I CCNGG 2 cut(s) 155, 344
MvaI CCWGG 1 cut(s) 344
MwoI GCNNNNNNNGC 2 cut(s) 96, 263
NciI CCSGG 1 cut(s) 155
NdeI CATATG 1 cut(s) 178
NdeII GATC 5 cut(s) 184, 210, 295, 300, 375
PfeI GAWTC 1 cut(s) 200
PkrI GCNGC 4 cut(s) 92, 95, 98, 239
Psp6I CCWGG 1 cut(s) 342
PspGI CCWGG 1 cut(s) 342
RseI CAYNNNNRTG 1 cut(s) 345
SaqAI TTAA 2 cut(s) 38, 409
SatI GCNGC 4 cut(s) 91, 94, 97, 238
Sau3AI GATC 5 cut(s) 184, 210, 295, 300, 375
ScrFI CCNGG 2 cut(s) 155, 344
SduI GDGCHC 1 cut(s) 360
SetI ASST 8 cut(s) 19, 79, 115, 138, 218, 239, 345, 383
SfaNI GCATC 1 cut(s) 287
SmiMI CAYNNNNRTG 1 cut(s) 345
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
Sse9I AATT 3 cut(s) 143, 322, 332
SsiI CCGC 1 cut(s) 170
StyD4I CCNGG 2 cut(s) 153, 342
TaiI ACGT 1 cut(s) 19
TaqI TCGA 3 cut(s) 130, 326, 354
TasI AATT 3 cut(s) 143, 322, 332
TfiI GAWTC 1 cut(s) 200
Tru1I TTAA 2 cut(s) 38, 409
Tru9I TTAA 2 cut(s) 38, 409
TseI GCWGC 4 cut(s) 90, 93, 96, 237
TspDTI ATGAA 2 cut(s) 17, 84
XapI RAATTY 2 cut(s) 322, 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.