Rw1G022450

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
47526795 .. 47527690
896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G022450.1

Sequence Viewer

Length: 501 bp
ATGAAGAAAGAAGATATTGCTAGAGGTTTGGAAAATAGTAACAAGGTGGATGCAGCTAATGTAGGCAGCAAGATTTTACCAGTAAGTGACTCGACGTTATCAACCTCTACTAACAAAAACCATGACCAACGTGGAGCATCAGAAAAGAAAGAAAGGATTAAGGGGGACAAGACTAAAACATTATCAAGAATGAAGGAGCTAATAAGATGGGCTGCTGCAGCAAAATCAGCTGAAAAGGGTGGAAAATACATTGGCCGAAAGGTTCTGCAATTTCGCAATCATGGAACTCTAAAACCAGTACCAGATGATGATCAGTTAAGCAATGACTCCCCAAAGATCAGCTTTAGATGGGAATTGGAAAGCTCATCTTCATTGAAGAATGATCAAATTATGAACATTCAATCTTTGAATTCAACGAAGCTTCAAGACTCAGATGACTGGCAACCCAAGAATGGGAATTGGATCACTTCAGACTCTGACTTTGTTGTGCTAGAGCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

166

Amino Acids

18.58

Weight (kDa)

9.22

Isoelectric Point (pI)

38.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 470
AcoI YGGCCR 1 cut(s) 253
AcsI RAATTY 1 cut(s) 409
AcuI CTGAAG 1 cut(s) 453
AfaI GTAC 1 cut(s) 300
AfiI CCNNNNNNNGG 2 cut(s) 452, 453
AgsI TTSAA 5 cut(s) 376, 401, 409, 414, 425
AluBI AGCT 7 cut(s) 56, 199, 230, 342, 363, 421, 496
AluI AGCT 7 cut(s) 56, 199, 230, 342, 363, 421, 496
AlwI GGATC 1 cut(s) 470
AlwNI CAGNNNCTG 1 cut(s) 476
AoxI GGCC 1 cut(s) 253
ApeKI GCWGC 5 cut(s) 53, 66, 212, 215, 218
ApoI RAATTY 1 cut(s) 409
ArsI GACNNNNNNTTYG 2 cut(s) 464, 496
BbvI GCAGC 5 cut(s) 65, 78, 199, 202, 230
BccI CCATC 2 cut(s) 201, 342
BclI TGATCA 2 cut(s) 310, 382
BfaI CTAG 2 cut(s) 21, 491
BfmI CTRYAG 1 cut(s) 216
BisI GCNGC 5 cut(s) 54, 67, 213, 216, 219
BlsI GCNGC 5 cut(s) 55, 68, 214, 217, 220
BmsI GCATC 2 cut(s) 40, 146
BsaBI GATNNNNATC 1 cut(s) 309
Bsc4I CCNNNNNNNGG 2 cut(s) 452, 453
Bse1I ACTGG 3 cut(s) 80, 296, 443
Bse3DI GCAATG 1 cut(s) 328
Bse8I GATNNNNATC 1 cut(s) 309
BseGI GGATG 1 cut(s) 55
BseJI GATNNNNATC 1 cut(s) 309
BseLI CCNNNNNNNGG 2 cut(s) 452, 453
BseMI GCAATG 1 cut(s) 328
BseMII CTCAG 1 cut(s) 444
BseNI ACTGG 3 cut(s) 80, 296, 443
BseXI GCAGC 5 cut(s) 65, 78, 199, 202, 230
BshFI GGCC 1 cut(s) 255
BslFI GGGAC 1 cut(s) 179
BslI CCNNNNNNNGG 2 cut(s) 452, 453
BsmFI GGGAC 1 cut(s) 179
BsnI GGCC 1 cut(s) 255
Bsp143I GATC 4 cut(s) 310, 336, 382, 462
BspANI GGCC 1 cut(s) 255
BspCNI CTCAG 1 cut(s) 443
BspMAI CTGCAG 1 cut(s) 220
BspPI GGATC 1 cut(s) 470
BsrDI GCAATG 1 cut(s) 328
BsrI ACTGG 3 cut(s) 80, 296, 443
BssMI GATC 4 cut(s) 310, 336, 382, 462
BstDEI CTNAG 1 cut(s) 430
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 4 cut(s) 313, 339, 385, 465
BstMBI GATC 4 cut(s) 310, 336, 382, 462
BstMWI GCNNNNNNNGC 2 cut(s) 218, 227
BstSFI CTRYAG 1 cut(s) 216
BstV1I GCAGC 5 cut(s) 65, 78, 199, 202, 230
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 1 cut(s) 55
CaiI CAGNNNCTG 1 cut(s) 476
Csp6I GTAC 1 cut(s) 299
CviAII CATG 2 cut(s) 122, 281
CviJI RGCY 9 cut(s) 56, 199, 212, 230, 255, 342, 363, 421, 496
CviKI_1 RGCY 9 cut(s) 56, 199, 212, 230, 255, 342, 363, 421, 496
CviQI GTAC 1 cut(s) 299
DdeI CTNAG 1 cut(s) 430
DpnI GATC 4 cut(s) 312, 338, 384, 464
DpnII GATC 4 cut(s) 310, 336, 382, 462
EaeI YGGCCR 1 cut(s) 253
Eco57I CTGAAG 1 cut(s) 453
EcoRI GAATTC 1 cut(s) 409
FaeI CATG 2 cut(s) 125, 284
FaiI YATR 4 cut(s) 123, 282, 392, 499
FalI AAGNNNNNCTT 4 cut(s) 326, 358, 352, 384
FaqI GGGAC 1 cut(s) 179
FatI CATG 2 cut(s) 121, 280
FbaI TGATCA 2 cut(s) 310, 382
Fnu4HI GCNGC 5 cut(s) 54, 67, 213, 216, 219
FokI GGATG 1 cut(s) 62
Fsp4HI GCNGC 5 cut(s) 54, 67, 213, 216, 219
FspBI CTAG 2 cut(s) 21, 491
GluI GCNGC 5 cut(s) 54, 67, 213, 216, 219
HaeIII GGCC 1 cut(s) 255
Hin1II CATG 2 cut(s) 125, 284
HindIII AAGCTT 1 cut(s) 419
HinfI GANTC 4 cut(s) 89, 326, 428, 473
Hpy188I TCNGA 4 cut(s) 142, 433, 472, 478
Hpy188III TCNNGA 2 cut(s) 186, 425
Hpy99I CGWCG 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 187
HpyCH4IV ACGT 2 cut(s) 95, 130
HpyCH4V TGCA 3 cut(s) 53, 218, 268
HpyF10VI GCNNNNNNNGC 2 cut(s) 218, 227
HpyF3I CTNAG 1 cut(s) 430
HpySE526I ACGT 2 cut(s) 95, 130
Hsp92II CATG 2 cut(s) 125, 284
Ksp22I TGATCA 2 cut(s) 310, 382
Kzo9I GATC 4 cut(s) 310, 336, 382, 462
LmnI GCTCC 2 cut(s) 134, 196
LpnPI CCDG 4 cut(s) 93, 309, 315, 424
Lsp1109I GCAGC 5 cut(s) 65, 78, 199, 202, 230
LweI GCATC 2 cut(s) 40, 146
MaeI CTAG 2 cut(s) 21, 491
MaeII ACGT 2 cut(s) 95, 130
MaeIII GTNAC 2 cut(s) 38, 86
MalI GATC 4 cut(s) 312, 338, 384, 464
MboI GATC 4 cut(s) 310, 336, 382, 462
MboII GAAGA 4 cut(s) 16, 23, 360, 388
MluCI AATT 5 cut(s) 269, 353, 387, 409, 457
MlyI GAGTC 4 cut(s) 83, 320, 422, 467
MnlI CCTC 2 cut(s) 17, 115
MseI TTAA 2 cut(s) 159, 317
MspA1I CMGCKG 1 cut(s) 230
MwoI GCNNNNNNNGC 2 cut(s) 218, 227
NdeII GATC 4 cut(s) 310, 336, 382, 462
NlaIII CATG 2 cut(s) 125, 284
NmuCI GTSAC 1 cut(s) 86
PkrI GCNGC 5 cut(s) 55, 68, 214, 217, 220
PleI GAGTC 4 cut(s) 83, 320, 422, 467
PpsI GAGTC 4 cut(s) 83, 320, 422, 467
PstI CTGCAG 1 cut(s) 220
PstNI CAGNNNCTG 1 cut(s) 476
PvuII CAGCTG 1 cut(s) 230
RsaI GTAC 1 cut(s) 300
RsaNI GTAC 1 cut(s) 299
SaqAI TTAA 2 cut(s) 159, 317
SatI GCNGC 5 cut(s) 54, 67, 213, 216, 219
Sau3AI GATC 4 cut(s) 310, 336, 382, 462
SchI GAGTC 4 cut(s) 83, 320, 422, 467
SfaNI GCATC 2 cut(s) 40, 146
SfcI CTRYAG 1 cut(s) 216
Sse9I AATT 5 cut(s) 269, 353, 387, 409, 457
SspMI CTAG 2 cut(s) 21, 491
TaiI ACGT 2 cut(s) 98, 133
TaqI TCGA 1 cut(s) 92
TasI AATT 5 cut(s) 269, 353, 387, 409, 457
Tru1I TTAA 2 cut(s) 159, 317
Tru9I TTAA 2 cut(s) 159, 317
TseFI GTSAC 1 cut(s) 86
TseI GCWGC 5 cut(s) 53, 66, 212, 215, 218
Tsp45I GTSAC 1 cut(s) 86
TspDTI ATGAA 4 cut(s) 17, 206, 360, 407
XapI RAATTY 1 cut(s) 409
XcmI CCANNNNNNNNNTGG 1 cut(s) 128
XspI CTAG 2 cut(s) 21, 491
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.