Rw0G004220

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00162
Physical Location & Seq
Forward (+)
133680 .. 134582
903 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G004220.1

Sequence Viewer

Length: 546 bp
ATGAAGATGAAGAAAGAAGATATTGCTAGAGGTTTGGAAAATAGTAACAAGGTGGATGCAGCTAATGTAGGCAGCAAGATTTTACCAGTAAGTGACTCGACGTTATCAACCTCTACTAACAAAAACCATGACCAACGTGGAGCATCAGAAAAGAAAGAAAGGATTAAGGGGGACAAGACTAAAACATTATCAAGAATGAAGGAGCTAATAAGATGGGCTGCTGCAGCAAAATCAGCTGAAAAGGGTGGAAAATACATTGGCCGAAAGGTTCTGCAATTTCGCAATCATGGAACTCTAAAACCAGTACCAGATGATGATCAGTTAAGCAATGACTCCCCAAAGATCAGCTTTAGATGGGAATTGGAAAGCTGCTCCACCACTTCCTCTGCCTACTCGGCAATTTCTGTAGCATCTTCATTGAAGAATGATCAAATTATGAACATTCAATCTTTGAATTCAACGAAGCTTCAAGACTCAGATGACTGGCAACCCAAGAATGGGAATTGGATCACTTCAGACTCTGACTTTGTTGTGCTAGAGCTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

181

Amino Acids

20.08

Weight (kDa)

9.23

Isoelectric Point (pI)

38.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 515
AcoI YGGCCR 1 cut(s) 259
AcsI RAATTY 1 cut(s) 454
AcuI CTGAAG 1 cut(s) 498
AfaI GTAC 1 cut(s) 306
AfiI CCNNNNNNNGG 2 cut(s) 497, 498
AgsI TTSAA 5 cut(s) 421, 446, 454, 459, 470
AluBI AGCT 7 cut(s) 62, 205, 236, 348, 369, 466, 541
AluI AGCT 7 cut(s) 62, 205, 236, 348, 369, 466, 541
AlwI GGATC 1 cut(s) 515
AlwNI CAGNNNCTG 1 cut(s) 521
AoxI GGCC 1 cut(s) 259
ApeKI GCWGC 6 cut(s) 59, 72, 218, 221, 224, 369
ApoI RAATTY 1 cut(s) 454
ArsI GACNNNNNNTTYG 2 cut(s) 509, 541
BbvI GCAGC 6 cut(s) 71, 84, 205, 208, 236, 356
BccI CCATC 2 cut(s) 207, 348
BclI TGATCA 2 cut(s) 316, 427
BfaI CTAG 2 cut(s) 27, 536
BfmI CTRYAG 2 cut(s) 222, 405
BglI GCCNNNNNGGC 1 cut(s) 395
BisI GCNGC 6 cut(s) 60, 73, 219, 222, 225, 370
BlsI GCNGC 6 cut(s) 61, 74, 220, 223, 226, 371
BmsI GCATC 3 cut(s) 46, 152, 419
BsaBI GATNNNNATC 1 cut(s) 315
Bsc4I CCNNNNNNNGG 2 cut(s) 497, 498
Bse1I ACTGG 3 cut(s) 86, 302, 488
Bse3DI GCAATG 1 cut(s) 334
Bse8I GATNNNNATC 1 cut(s) 315
BseGI GGATG 1 cut(s) 61
BseJI GATNNNNATC 1 cut(s) 315
BseLI CCNNNNNNNGG 2 cut(s) 497, 498
BseMI GCAATG 1 cut(s) 334
BseMII CTCAG 1 cut(s) 489
BseNI ACTGG 3 cut(s) 86, 302, 488
BseXI GCAGC 6 cut(s) 71, 84, 205, 208, 236, 356
BshFI GGCC 1 cut(s) 261
BslFI GGGAC 1 cut(s) 185
BslI CCNNNNNNNGG 2 cut(s) 497, 498
BsmFI GGGAC 1 cut(s) 185
BsnI GGCC 1 cut(s) 261
Bsp143I GATC 4 cut(s) 316, 342, 427, 507
BspANI GGCC 1 cut(s) 261
BspCNI CTCAG 1 cut(s) 488
BspMAI CTGCAG 1 cut(s) 226
BspPI GGATC 1 cut(s) 515
BsrDI GCAATG 1 cut(s) 334
BsrI ACTGG 3 cut(s) 86, 302, 488
BssMI GATC 4 cut(s) 316, 342, 427, 507
BstDEI CTNAG 1 cut(s) 475
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 4 cut(s) 319, 345, 430, 510
BstMBI GATC 4 cut(s) 316, 342, 427, 507
BstMWI GCNNNNNNNGC 3 cut(s) 224, 233, 395
BstSFI CTRYAG 2 cut(s) 222, 405
BstV1I GCAGC 6 cut(s) 71, 84, 205, 208, 236, 356
BsuRI GGCC 1 cut(s) 261
BtsCI GGATG 1 cut(s) 61
CaiI CAGNNNCTG 1 cut(s) 521
Csp6I GTAC 1 cut(s) 305
CviAII CATG 2 cut(s) 128, 287
CviJI RGCY 9 cut(s) 62, 205, 218, 236, 261, 348, 369, 466, 541
CviKI_1 RGCY 9 cut(s) 62, 205, 218, 236, 261, 348, 369, 466, 541
CviQI GTAC 1 cut(s) 305
DdeI CTNAG 1 cut(s) 475
DpnI GATC 4 cut(s) 318, 344, 429, 509
DpnII GATC 4 cut(s) 316, 342, 427, 507
EaeI YGGCCR 1 cut(s) 259
Eco57I CTGAAG 1 cut(s) 498
EcoRI GAATTC 1 cut(s) 454
FaeI CATG 2 cut(s) 131, 290
FaiI YATR 4 cut(s) 129, 288, 437, 544
FalI AAGNNNNNCTT 2 cut(s) 332, 364
FaqI GGGAC 1 cut(s) 185
FatI CATG 2 cut(s) 127, 286
FbaI TGATCA 2 cut(s) 316, 427
Fnu4HI GCNGC 6 cut(s) 60, 73, 219, 222, 225, 370
FokI GGATG 1 cut(s) 68
Fsp4HI GCNGC 6 cut(s) 60, 73, 219, 222, 225, 370
FspBI CTAG 2 cut(s) 27, 536
GluI GCNGC 6 cut(s) 60, 73, 219, 222, 225, 370
HaeIII GGCC 1 cut(s) 261
Hin1II CATG 2 cut(s) 131, 290
HindIII AAGCTT 1 cut(s) 464
HinfI GANTC 4 cut(s) 95, 332, 473, 518
Hpy188I TCNGA 4 cut(s) 148, 478, 517, 523
Hpy188III TCNNGA 2 cut(s) 192, 470
Hpy99I CGWCG 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 193
HpyCH4IV ACGT 2 cut(s) 101, 136
HpyCH4V TGCA 3 cut(s) 59, 224, 274
HpyF10VI GCNNNNNNNGC 3 cut(s) 224, 233, 395
HpyF3I CTNAG 1 cut(s) 475
HpySE526I ACGT 2 cut(s) 101, 136
Hsp92II CATG 2 cut(s) 131, 290
Ksp22I TGATCA 2 cut(s) 316, 427
Kzo9I GATC 4 cut(s) 316, 342, 427, 507
LmnI GCTCC 3 cut(s) 140, 202, 377
LpnPI CCDG 4 cut(s) 99, 315, 321, 469
Lsp1109I GCAGC 6 cut(s) 71, 84, 205, 208, 236, 356
LweI GCATC 3 cut(s) 46, 152, 419
MaeI CTAG 2 cut(s) 27, 536
MaeII ACGT 2 cut(s) 101, 136
MaeIII GTNAC 2 cut(s) 44, 92
MalI GATC 4 cut(s) 318, 344, 429, 509
MboI GATC 4 cut(s) 316, 342, 427, 507
MboII GAAGA 5 cut(s) 16, 22, 29, 405, 433
MluCI AATT 6 cut(s) 275, 359, 399, 432, 454, 502
MlyI GAGTC 4 cut(s) 89, 326, 467, 512
MnlI CCTC 3 cut(s) 23, 121, 394
MseI TTAA 2 cut(s) 165, 323
MspA1I CMGCKG 1 cut(s) 236
MwoI GCNNNNNNNGC 3 cut(s) 224, 233, 395
NdeII GATC 4 cut(s) 316, 342, 427, 507
NlaIII CATG 2 cut(s) 131, 290
NmeAIII GCCGAG 1 cut(s) 374
NmuCI GTSAC 1 cut(s) 92
PkrI GCNGC 6 cut(s) 61, 74, 220, 223, 226, 371
PleI GAGTC 4 cut(s) 89, 326, 467, 512
PpsI GAGTC 4 cut(s) 89, 326, 467, 512
PstI CTGCAG 1 cut(s) 226
PstNI CAGNNNCTG 1 cut(s) 521
PvuII CAGCTG 1 cut(s) 236
RsaI GTAC 1 cut(s) 306
RsaNI GTAC 1 cut(s) 305
SaqAI TTAA 2 cut(s) 165, 323
SatI GCNGC 6 cut(s) 60, 73, 219, 222, 225, 370
Sau3AI GATC 4 cut(s) 316, 342, 427, 507
SchI GAGTC 4 cut(s) 89, 326, 467, 512
SfaNI GCATC 3 cut(s) 46, 152, 419
SfcI CTRYAG 2 cut(s) 222, 405
Sse9I AATT 6 cut(s) 275, 359, 399, 432, 454, 502
SspMI CTAG 2 cut(s) 27, 536
TaiI ACGT 2 cut(s) 104, 139
TaqI TCGA 1 cut(s) 98
TasI AATT 6 cut(s) 275, 359, 399, 432, 454, 502
Tru1I TTAA 2 cut(s) 165, 323
Tru9I TTAA 2 cut(s) 165, 323
TseFI GTSAC 1 cut(s) 92
TseI GCWGC 6 cut(s) 59, 72, 218, 221, 224, 369
Tsp45I GTSAC 1 cut(s) 92
TspDTI ATGAA 5 cut(s) 17, 23, 212, 405, 452
XapI RAATTY 1 cut(s) 454
XcmI CCANNNNNNNNNTGG 1 cut(s) 134
XspI CTAG 2 cut(s) 27, 536
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.