Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr12

Orthogroup ID

OG0006415

Physical Location & Seq

Genomic Coordinates Forward (+)

2451857 .. 2454959

Gene Structure 3103 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom12g02720.3

Sequence Viewer

CDS Protein Promoter (2k)

Length: 534 bp

ATGTTAGTCCCAGCATGGAACAAACACAGTATTGGACTAATAGCTAGTCCAGTCCAGTCCATTTCGGAAAACAGGTTTCTGGTGGGGCATTGCTATCCTTCTTGTCCCCAGCCTGATCGGACCATGGGGATTACGGCGCATACTGATGTTACAGCTCTGACGGTTCTGTTGCGGAACCATGTACCTGGGTTGCAAGTTAGGCATGAGAATGAGTGGCTGGATGTGAAGACTGTGCCTGGAGGTTTGATTATTAACGTTGGAGACTTGCTTCAGATCATCTCCAATGGGGAGTATAAAAGTGTGCAGCACAGGGTGTTGGCCAACTCATGGAAAGAAGCTCGAATCTCTGTTGTGATGTTTTTTTACCATACCAAATGGAGAGAAAATAATTACTATGGACCTCTTCCTGAGCTTTTGTCACCAGAGAAACCACCAATCTATCGAGACTTCACTAAACATGAAATACTTGAAAATTACTATAGCAAAGGATTAGATAGCAAATCTTTCATTGACAAAGTCACAATAAAAAACTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

2OG-FeII_Oxy DIOX_N

Protein Analysis

178

Amino Acids

20.24

Weight (kDa)

8.5

Isoelectric Point (pI)

40.64

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006415)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g19280 FvH4_6g19280 FvH4_6g19281
malus_domestica	MD12G1028400.v1.1 MD12G1028500.v1.1 MD14G1028700.v1.1
prunus_persica	Prupe.7G102900_v2.0.a1 Prupe.7G103000_v2.0.a1
pyrus_communis	pycom12g02720 pycom12g02730 pycom14g02670 pycom14g02680
rosa_chinensis	RchiOBHm_Chr3g0474491
rosa_laevigata	RLG00000023917 RLG00000023927 RLG00000023928
rosa_multiflora	Rmu_sc0001353.1_g000045 Rmu_sc0039676.1_g000001
rosa_roxburghii	Rroxscaffold_6G00407120 Rroxscaffold_6G00407300
rosa_rugosa	Rorug03G0140600 Rorug03G0141100
rosa_samantha	Rh3AG192000 Rh3BG221500 Rh3CG216200 Rh3DG216900
rosa_wichuraiana	Rw3G017450

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	327
AciI	CCGC	1 cut(s)	172
AclI	AACGTT	1 cut(s)	255
AcoI	YGGCCR	1 cut(s)	318
AcuI	CTGAAG	1 cut(s)	254
AdeI	CACNNNGTG	1 cut(s)	313
AfaI	GTAC	1 cut(s)	183
AfiI	CCNNNNNNNGG	1 cut(s)	327
AgsI	TTSAA	1 cut(s)	470
AjnI	CCWGG	2 cut(s)	184, 235
AluBI	AGCT	4 cut(s)	44, 155, 338, 412
AluI	AGCT	4 cut(s)	44, 155, 338, 412
Alw26I	GTCTC	2 cut(s)	255, 438
AoxI	GGCC	1 cut(s)	318
ApeKI	GCWGC	1 cut(s)	304
AspLEI	GCGC	1 cut(s)	139
AspS9I	GGNCC	2 cut(s)	120, 398
AsuHPI	GGTGA	1 cut(s)	411
AvaII	GGWCC	2 cut(s)	120, 398
BalI	TGGCCA	1 cut(s)	320
BbsI	GAAGAC	1 cut(s)	233
BbvI	GCAGC	1 cut(s)	316
BceAI	ACGGC	1 cut(s)	150
BciT130I	CCWGG	2 cut(s)	186, 237
BcoDI	GTCTC	2 cut(s)	255, 438
BfaI	CTAG	1 cut(s)	45
BfmI	CTRYAG	1 cut(s)	478
BisI	GCNGC	1 cut(s)	305
BlsI	GCNGC	1 cut(s)	306
Bme1390I	CCNGG	2 cut(s)	186, 237
Bme18I	GGWCC	2 cut(s)	120, 398
BmgT120I	GGNCC	2 cut(s)	120, 398
BmiI	GGNNCC	1 cut(s)	176
BmrFI	CCNGG	2 cut(s)	186, 237
BpiI	GAAGAC	1 cut(s)	233
BpmI	CTGGAG	1 cut(s)	258
Bpu10I	CCTNAGC	1 cut(s)	408
BsaJI	CCNNGG	2 cut(s)	123, 185
Bsc4I	CCNNNNNNNGG	1 cut(s)	327
Bse1I	ACTGG	2 cut(s)	50, 55
Bse3DI	GCAATG	1 cut(s)	88
BseBI	CCWGG	2 cut(s)	186, 237
BseDI	CCNNGG	2 cut(s)	123, 185
BseGI	GGATG	1 cut(s)	226
BseLI	CCNNNNNNNGG	1 cut(s)	327
BseMI	GCAATG	1 cut(s)	88
BseMII	CTCAG	1 cut(s)	399
BseNI	ACTGG	2 cut(s)	50, 55
BseXI	GCAGC	1 cut(s)	316
BseYI	CCCAGC	2 cut(s)	10, 108
BsgI	GTGCAG	1 cut(s)	323
BshFI	GGCC	1 cut(s)	320
BslFI	GGGAC	1 cut(s)	90
BslI	CCNNNNNNNGG	1 cut(s)	327
BsmAI	GTCTC	2 cut(s)	255, 438
BsmFI	GGGAC	1 cut(s)	90
BsnI	GGCC	1 cut(s)	320
Bsp143I	GATC	2 cut(s)	115, 273
Bsp19I	CCATGG	1 cut(s)	123
BspACI	CCGC	1 cut(s)	172
BspANI	GGCC	1 cut(s)	320
BspCNI	CTCAG	1 cut(s)	400
BspLI	GGNNCC	1 cut(s)	176
BsrDI	GCAATG	1 cut(s)	88
BsrI	ACTGG	2 cut(s)	50, 55
BssECI	CCNNGG	2 cut(s)	123, 185
BssMI	GATC	2 cut(s)	115, 273
BssT1I	CCWWGG	1 cut(s)	123
Bst2UI	CCWGG	2 cut(s)	186, 237
Bst4CI	ACNGT	3 cut(s)	29, 163, 232
Bst6I	CTCTTC	1 cut(s)	408
BstDEI	CTNAG	1 cut(s)	408
BstDSI	CCRYGG	1 cut(s)	123
BstF5I	GGATG	1 cut(s)	226
BstHHI	GCGC	1 cut(s)	139
BstKTI	GATC	2 cut(s)	118, 276
BstMAI	GTCTC	2 cut(s)	255, 438
BstMBI	GATC	2 cut(s)	115, 273
BstMWI	GCNNNNNNNGC	1 cut(s)	199
BstNI	CCWGG	2 cut(s)	186, 237
BstSCI	CCNGG	2 cut(s)	184, 235
BstSFI	CTRYAG	1 cut(s)	478
BstV1I	GCAGC	1 cut(s)	316
BstV2I	GAAGAC	1 cut(s)	233
BstXI	CCANNNNNNTGG	1 cut(s)	185
BsuRI	GGCC	1 cut(s)	320
BtgI	CCRYGG	1 cut(s)	123
BtsCI	GGATG	1 cut(s)	226
CfoI	GCGC	1 cut(s)	139
Cfr13I	GGNCC	2 cut(s)	120, 398
Csp6I	GTAC	1 cut(s)	182
CviAII	CATG	6 cut(s)	15, 124, 179, 203, 327, 458
CviJI	RGCY	7 cut(s)	44, 112, 155, 217, 320, 338, 412
CviKI_1	RGCY	7 cut(s)	44, 112, 155, 217, 320, 338, 412
CviQI	GTAC	1 cut(s)	182
DdeI	CTNAG	1 cut(s)	408
DpnI	GATC	2 cut(s)	117, 275
DpnII	GATC	2 cut(s)	115, 273
DraIII	CACNNNGTG	1 cut(s)	313
EaeI	YGGCCR	1 cut(s)	318
Eam1104I	CTCTTC	1 cut(s)	408
EarI	CTCTTC	1 cut(s)	408
Eco130I	CCWWGG	1 cut(s)	123
Eco47I	GGWCC	2 cut(s)	120, 398
Eco57I	CTGAAG	1 cut(s)	254
EcoRII	CCWGG	2 cut(s)	184, 235
EcoT14I	CCWWGG	1 cut(s)	123
ErhI	CCWWGG	1 cut(s)	123
FaeI	CATG	6 cut(s)	18, 127, 182, 206, 330, 461
FaqI	GGGAC	1 cut(s)	90
FatI	CATG	6 cut(s)	14, 123, 178, 202, 326, 457
Fnu4HI	GCNGC	1 cut(s)	305
FokI	GGATG	1 cut(s)	233
Fsp4HI	GCNGC	1 cut(s)	305
FspBI	CTAG	1 cut(s)	45
GlaI	GCGC	1 cut(s)	138
GluI	GCNGC	1 cut(s)	305
GsaI	CCCAGC	2 cut(s)	14, 112
GsuI	CTGGAG	1 cut(s)	258
HaeIII	GGCC	1 cut(s)	320
HhaI	GCGC	1 cut(s)	139
Hin1II	CATG	6 cut(s)	18, 127, 182, 206, 330, 461
Hin6I	GCGC	1 cut(s)	137
HinP1I	GCGC	1 cut(s)	137
HinfI	GANTC	1 cut(s)	342
HphI	GGTGA	1 cut(s)	411
Hpy188I	TCNGA	4 cut(s)	67, 120, 159, 273
Hpy188III	TCNNGA	2 cut(s)	407, 443
HpyAV	CCTTC	1 cut(s)	108
HpyCH4III	ACNGT	3 cut(s)	29, 163, 232
HpyCH4IV	ACGT	1 cut(s)	255
HpyCH4V	TGCA	2 cut(s)	193, 304
HpyF10VI	GCNNNNNNNGC	1 cut(s)	199
HpyF3I	CTNAG	1 cut(s)	408
HpySE526I	ACGT	1 cut(s)	255
Hsp92II	CATG	6 cut(s)	18, 127, 182, 206, 330, 461
HspAI	GCGC	1 cut(s)	137
Kzo9I	GATC	2 cut(s)	115, 273
Lsp1109I	GCAGC	1 cut(s)	316
MaeI	CTAG	1 cut(s)	45
MaeII	ACGT	1 cut(s)	255
MaeIII	GTNAC	3 cut(s)	148, 417, 517
MalI	GATC	2 cut(s)	117, 275
MboI	GATC	2 cut(s)	115, 273
MboII	GAAGA	2 cut(s)	238, 395
MlsI	TGGCCA	1 cut(s)	320
MluCI	AATT	2 cut(s)	388, 472
MluNI	TGGCCA	1 cut(s)	320
MmeI	TCCRAC	1 cut(s)	238
MnlI	CCTC	2 cut(s)	233, 411
Mox20I	TGGCCA	1 cut(s)	320
MscI	TGGCCA	1 cut(s)	320
MseI	TTAA	1 cut(s)	252
MslI	CAYNNNNRTG	2 cut(s)	144, 207
Msp20I	TGGCCA	1 cut(s)	320
MspR9I	CCNGG	2 cut(s)	186, 237
MvaI	CCWGG	2 cut(s)	186, 237
MwoI	GCNNNNNNNGC	1 cut(s)	199
NcoI	CCATGG	1 cut(s)	123
NdeII	GATC	2 cut(s)	115, 273
NlaIII	CATG	6 cut(s)	18, 127, 182, 206, 330, 461
NlaIV	GGNNCC	1 cut(s)	176
NmuCI	GTSAC	2 cut(s)	417, 517
PfeI	GAWTC	1 cut(s)	342
PflFI	GACNNNGTC	1 cut(s)	515
PflMI	CCANNNNNTGG	1 cut(s)	327
PkrI	GCNGC	1 cut(s)	306
Psp1406I	AACGTT	1 cut(s)	255
Psp6I	CCWGG	2 cut(s)	184, 235
PspFI	CCCAGC	2 cut(s)	10, 108
PspGI	CCWGG	2 cut(s)	184, 235
PspN4I	GGNNCC	1 cut(s)	176
PspPI	GGNCC	2 cut(s)	120, 398
PsyI	GACNNNGTC	1 cut(s)	515
RsaI	GTAC	1 cut(s)	183
RsaNI	GTAC	1 cut(s)	182
RseI	CAYNNNNRTG	2 cut(s)	144, 207
SaqAI	TTAA	1 cut(s)	252
SatI	GCNGC	1 cut(s)	305
Sau3AI	GATC	2 cut(s)	115, 273
Sau96I	GGNCC	2 cut(s)	120, 398
ScrFI	CCNGG	2 cut(s)	186, 237
SetI	ASST	9 cut(s)	46, 77, 157, 187, 244, 258, 340, 403, 414
SfcI	CTRYAG	1 cut(s)	478
SinI	GGWCC	2 cut(s)	120, 398
SmiMI	CAYNNNNRTG	2 cut(s)	144, 207
Sse9I	AATT	2 cut(s)	388, 472
SsiI	CCGC	1 cut(s)	172
SspMI	CTAG	1 cut(s)	45
StyD4I	CCNGG	2 cut(s)	184, 235
StyI	CCWWGG	1 cut(s)	123
TaaI	ACNGT	3 cut(s)	29, 163, 232
TaiI	ACGT	1 cut(s)	258
TaqI	TCGA	2 cut(s)	340, 442
TasI	AATT	2 cut(s)	388, 472
TfiI	GAWTC	1 cut(s)	342
Tru1I	TTAA	1 cut(s)	252
Tru9I	TTAA	1 cut(s)	252
TseFI	GTSAC	2 cut(s)	417, 517
TseI	GCWGC	1 cut(s)	304
Tsp45I	GTSAC	2 cut(s)	417, 517
TspDTI	ATGAA	2 cut(s)	474, 496
Tth111I	GACNNNGTC	1 cut(s)	515
Van91I	CCANNNNNTGG	1 cut(s)	327
VpaK11BI	GGWCC	2 cut(s)	120, 398
XspI	CTAG	1 cut(s)	45

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.