pycom12g05740

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Reverse (-)
5683783 .. 5684031
249 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g05740.1

Sequence Viewer

Length: 249 bp
ATGGACATGAAGAAGATCTCCCTTATCCTCATTTTCGTAGCTGCCTTGATGAGTCTGGTCTTGGCTGCAGTAGCTAAGGAGGCCCCGAAGACAACAGCAGCTGCTGCCCCCAAGGAATCAGCTCCAACCGCCAAAGACACAGCAGCGCACGCCCCTGCCCCTAGCTCCGCCTTTACTCCCTTTCCCGATGTTGGGTCTTTGGCTGCTGCCTCCCTTTTGTCTTTCTTTGCCTATTACATGCAATACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

83

Amino Acids

8.48

Weight (kDa)

8.03

Isoelectric Point (pI)

42.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 129, 168
AfiI CCNNNNNNNGG 2 cut(s) 191, 192
AluBI AGCT 5 cut(s) 41, 74, 101, 122, 165
AluI AGCT 5 cut(s) 41, 74, 101, 122, 165
AlwNI CAGNNNCTG 2 cut(s) 101, 104
AoxI GGCC 1 cut(s) 81
ApeKI GCWGC 8 cut(s) 41, 65, 98, 101, 104, 143, 203, 206
AspLEI GCGC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 95
BbvI GCAGC 8 cut(s) 28, 52, 88, 91, 110, 155, 190, 193
BfaI CTAG 1 cut(s) 162
BfmI CTRYAG 1 cut(s) 66
BglII AGATCT 1 cut(s) 15
BisI GCNGC 8 cut(s) 42, 66, 99, 102, 105, 144, 204, 207
BlsI GCNGC 8 cut(s) 43, 67, 100, 103, 106, 145, 205, 208
BmgT120I GGNCC 1 cut(s) 82
BmiI GGNNCC 1 cut(s) 84
BpiI GAAGAC 1 cut(s) 95
Bpu10I CCTNAGC 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 2 cut(s) 191, 192
BseDI CCNNGG 1 cut(s) 111
BseLI CCNNNNNNNGG 2 cut(s) 191, 192
BseXI GCAGC 8 cut(s) 28, 52, 88, 91, 110, 155, 190, 193
BshFI GGCC 1 cut(s) 83
BslI CCNNNNNNNGG 2 cut(s) 191, 192
BsnI GGCC 1 cut(s) 83
Bsp143I GATC 1 cut(s) 15
BspACI CCGC 2 cut(s) 129, 168
BspANI GGCC 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 84
BspMAI CTGCAG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 111
BssMI GATC 1 cut(s) 15
BssT1I CCWWGG 1 cut(s) 111
BstAPI GCANNNNNTGC 1 cut(s) 104
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 75
BstHHI GCGC 1 cut(s) 148
BstKTI GATC 1 cut(s) 18
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 5 cut(s) 71, 80, 104, 128, 149
BstNSI RCATGY 1 cut(s) 241
BstSFI CTRYAG 1 cut(s) 66
BstV1I GCAGC 8 cut(s) 28, 52, 88, 91, 110, 155, 190, 193
BstV2I GAAGAC 1 cut(s) 95
BstX2I RGATCY 1 cut(s) 15
BstYI RGATCY 1 cut(s) 15
BsuRI GGCC 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 150
CaiI CAGNNNCTG 2 cut(s) 101, 104
CfoI GCGC 1 cut(s) 148
Cfr13I GGNCC 1 cut(s) 82
CviAII CATG 2 cut(s) 7, 238
CviJI RGCY 8 cut(s) 41, 65, 74, 83, 101, 122, 165, 203
CviKI_1 RGCY 8 cut(s) 41, 65, 74, 83, 101, 122, 165, 203
DdeI CTNAG 1 cut(s) 75
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
EciI GGCGGA 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 111
EcoO109I RGGNCCY 1 cut(s) 82
EcoT14I CCWWGG 1 cut(s) 111
ErhI CCWWGG 1 cut(s) 111
FaeI CATG 2 cut(s) 10, 241
FaiI YATR 2 cut(s) 8, 239
FatI CATG 2 cut(s) 6, 237
Fnu4HI GCNGC 8 cut(s) 42, 66, 99, 102, 105, 144, 204, 207
Fsp4HI GCNGC 8 cut(s) 42, 66, 99, 102, 105, 144, 204, 207
FspBI CTAG 1 cut(s) 162
GlaI GCGC 1 cut(s) 147
GluI GCNGC 8 cut(s) 42, 66, 99, 102, 105, 144, 204, 207
HaeIII GGCC 1 cut(s) 83
HhaI GCGC 1 cut(s) 148
Hin1II CATG 2 cut(s) 10, 241
Hin6I GCGC 1 cut(s) 146
HinP1I GCGC 1 cut(s) 146
HinfI GANTC 2 cut(s) 52, 116
Hpy188III TCNNGA 1 cut(s) 185
HpyCH4V TGCA 2 cut(s) 68, 241
HpyF10VI GCNNNNNNNGC 5 cut(s) 71, 80, 104, 128, 149
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 2 cut(s) 10, 241
HspAI GCGC 1 cut(s) 146
Kzo9I GATC 1 cut(s) 15
LmnI GCTCC 2 cut(s) 127, 170
LpnPI CCDG 2 cut(s) 41, 168
Lsp1109I GCAGC 8 cut(s) 28, 52, 88, 91, 110, 155, 190, 193
MaeI CTAG 1 cut(s) 162
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MboII GAAGA 3 cut(s) 22, 25, 100
MflI RGATCY 1 cut(s) 15
MlyI GAGTC 1 cut(s) 61
MmeI TCCRAC 1 cut(s) 149
MnlI CCTC 3 cut(s) 38, 73, 220
MspA1I CMGCKG 1 cut(s) 101
MwoI GCNNNNNNNGC 5 cut(s) 71, 80, 104, 128, 149
NdeII GATC 1 cut(s) 15
NlaIII CATG 2 cut(s) 10, 241
NlaIV GGNNCC 1 cut(s) 84
NspI RCATGY 1 cut(s) 241
PfeI GAWTC 1 cut(s) 116
PkrI GCNGC 8 cut(s) 43, 67, 100, 103, 106, 145, 205, 208
PleI GAGTC 1 cut(s) 60
PpsI GAGTC 1 cut(s) 60
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 82
PstI CTGCAG 1 cut(s) 70
PstNI CAGNNNCTG 2 cut(s) 101, 104
PsuI RGATCY 1 cut(s) 15
PvuII CAGCTG 1 cut(s) 101
SatI GCNGC 8 cut(s) 42, 66, 99, 102, 105, 144, 204, 207
Sau3AI GATC 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 82
SchI GAGTC 1 cut(s) 61
SetI ASST 5 cut(s) 43, 76, 103, 124, 167
SfcI CTRYAG 1 cut(s) 66
SsiI CCGC 2 cut(s) 129, 168
SspMI CTAG 1 cut(s) 162
StyI CCWWGG 1 cut(s) 111
TfiI GAWTC 1 cut(s) 116
TseI GCWGC 8 cut(s) 41, 65, 98, 101, 104, 143, 203, 206
TspDTI ATGAA 1 cut(s) 23
XceI RCATGY 1 cut(s) 241
XspI CTAG 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.