pycom12g22310

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
OG0005172
Physical Location & Seq
Forward (+)
23257807 .. 23258235
429 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g22310.1

Sequence Viewer

Length: 429 bp
ATGGGAAATAGTGAAGCAAAACAGCAAGAACGCCGCAAGCATTTCGAATTTCCAGCCTCACATTCTCCAAACACTTCACATCTGAGCCATGATCATACTCGCTATTCGAATAGTATCCAGGTCAAACCAACTAATGCGTCTGGAGCTGAAGATGCGCAGATTGGAACGGCACAAGTGCAAAAGGGAGAGATGAATTTGGAAGACAATGATGCATTTTCTGACTACATTAACCGCATGAAATTTAAGATCAGAGCTACGACCTCCAATATTGATCCCGACAATGATGCATCCACAGCAGATGGTGTTTATGAAACAAAGCAAGAAGATAATGAGTATGAAATGTTTACGGATTTTGTCAACCACTCTAAGTTTAAGATTAGAAAGACATCCAGCATCGGAAGTAGAAACAACATCTCCTTTAAGAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

16.14

Weight (kDa)

6.29

Isoelectric Point (pI)

26.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 156
AciI CCGC 2 cut(s) 34, 232
AclWI GGATC 1 cut(s) 266
AcsI RAATTY 3 cut(s) 47, 193, 239
AcuI CTGAAG 1 cut(s) 168
AjnI CCWGG 1 cut(s) 117
AluBI AGCT 2 cut(s) 146, 254
AluI AGCT 2 cut(s) 146, 254
AlwI GGATC 1 cut(s) 266
ApoI RAATTY 3 cut(s) 47, 193, 239
AspLEI GCGC 1 cut(s) 157
AsuII TTCGAA 2 cut(s) 45, 107
BbsI GAAGAC 1 cut(s) 207
BccI CCATC 1 cut(s) 293
BceAI ACGGC 1 cut(s) 183
BcgI CGANNNNNNTGC 4 cut(s) 25, 59, 266, 300
BciT130I CCWGG 1 cut(s) 119
BciVI GTATCC 1 cut(s) 125
BclI TGATCA 1 cut(s) 91
BfuI GTATCC 1 cut(s) 125
BisI GCNGC 1 cut(s) 34
BlsI GCNGC 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 119
BmsI GCATC 5 cut(s) 142, 199, 274, 296, 402
BpiI GAAGAC 1 cut(s) 207
BpmI CTGGAG 1 cut(s) 162
Bpu14I TTCGAA 2 cut(s) 45, 107
BsaXI ACNNNNNCTCC 2 cut(s) 398, 428
BseBI CCWGG 1 cut(s) 119
BseGI GGATG 2 cut(s) 287, 386
BseMII CTCAG 1 cut(s) 74
Bsp119I TTCGAA 2 cut(s) 45, 107
Bsp143I GATC 3 cut(s) 91, 246, 271
BspACI CCGC 2 cut(s) 34, 232
BspCNI CTCAG 1 cut(s) 75
BspPI GGATC 1 cut(s) 266
BspT104I TTCGAA 2 cut(s) 45, 107
BssMI GATC 3 cut(s) 91, 246, 271
Bst2UI CCWGG 1 cut(s) 119
BstBI TTCGAA 2 cut(s) 45, 107
BstC8I GCNNGC 1 cut(s) 38
BstDEI CTNAG 2 cut(s) 83, 366
BstF5I GGATG 2 cut(s) 287, 386
BstHHI GCGC 1 cut(s) 157
BstKTI GATC 3 cut(s) 94, 249, 274
BstMBI GATC 3 cut(s) 91, 246, 271
BstMWI GCNNNNNNNGC 3 cut(s) 143, 152, 293
BstNI CCWGG 1 cut(s) 119
BstSCI CCNGG 1 cut(s) 117
BstV2I GAAGAC 1 cut(s) 207
BsuI GTATCC 1 cut(s) 125
BtsCI GGATG 2 cut(s) 287, 386
Cac8I GCNNGC 1 cut(s) 38
CfoI GCGC 1 cut(s) 157
CseI GACGC 1 cut(s) 126
CviAII CATG 2 cut(s) 89, 235
CviJI RGCY 4 cut(s) 56, 87, 146, 254
CviKI_1 RGCY 4 cut(s) 56, 87, 146, 254
DdeI CTNAG 2 cut(s) 83, 366
DpnI GATC 3 cut(s) 93, 248, 273
DpnII GATC 3 cut(s) 91, 246, 271
Eco57I CTGAAG 1 cut(s) 168
EcoRII CCWGG 1 cut(s) 117
EcoT22I ATGCAT 2 cut(s) 214, 289
FaeI CATG 2 cut(s) 92, 238
FaiI YATR 5 cut(s) 90, 96, 236, 309, 336
FatI CATG 2 cut(s) 88, 234
FbaI TGATCA 1 cut(s) 91
Fnu4HI GCNGC 1 cut(s) 34
FokI GGATG 2 cut(s) 274, 373
Fsp4HI GCNGC 1 cut(s) 34
FspI TGCGCA 1 cut(s) 156
GlaI GCGC 1 cut(s) 156
GluI GCNGC 1 cut(s) 34
GsuI CTGGAG 1 cut(s) 162
HgaI GACGC 1 cut(s) 126
HhaI GCGC 1 cut(s) 157
Hin1II CATG 2 cut(s) 92, 238
Hin6I GCGC 1 cut(s) 155
HinP1I GCGC 1 cut(s) 155
HincII GTYRAC 1 cut(s) 358
HindII GTYRAC 1 cut(s) 358
Hpy166II GTNNAC 2 cut(s) 345, 358
Hpy188I TCNGA 4 cut(s) 84, 220, 251, 398
Hpy188III TCNNGA 2 cut(s) 141, 275
Hpy8I GTNNAC 2 cut(s) 345, 358
HpyCH4V TGCA 3 cut(s) 178, 212, 287
HpyF10VI GCNNNNNNNGC 3 cut(s) 143, 152, 293
HpyF3I CTNAG 2 cut(s) 83, 366
Hsp92II CATG 2 cut(s) 92, 238
HspAI GCGC 1 cut(s) 155
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 3 cut(s) 91, 246, 271
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 66, 104, 126, 131, 403
LweI GCATC 5 cut(s) 142, 199, 274, 296, 402
MalI GATC 3 cut(s) 93, 248, 273
MboI GATC 3 cut(s) 91, 246, 271
MboII GAAGA 3 cut(s) 161, 212, 335
MluCI AATT 3 cut(s) 47, 193, 239
MnlI CCTC 2 cut(s) 67, 271
Mph1103I ATGCAT 2 cut(s) 214, 289
MseI TTAA 4 cut(s) 228, 243, 372, 420
MspR9I CCNGG 1 cut(s) 119
MvaI CCWGG 1 cut(s) 119
MwoI GCNNNNNNNGC 3 cut(s) 143, 152, 293
NdeII GATC 3 cut(s) 91, 246, 271
NlaIII CATG 2 cut(s) 92, 238
NsbI TGCGCA 1 cut(s) 156
NsiI ATGCAT 2 cut(s) 214, 289
NspV TTCGAA 2 cut(s) 45, 107
PkrI GCNGC 1 cut(s) 35
Psp6I CCWGG 1 cut(s) 117
PspGI CCWGG 1 cut(s) 117
SaqAI TTAA 4 cut(s) 228, 243, 372, 420
SatI GCNGC 1 cut(s) 34
Sau3AI GATC 3 cut(s) 91, 246, 271
ScrFI CCNGG 1 cut(s) 119
SetI ASST 4 cut(s) 123, 148, 256, 263
SfaNI GCATC 5 cut(s) 142, 199, 274, 296, 402
SfuI TTCGAA 2 cut(s) 45, 107
Sse9I AATT 3 cut(s) 47, 193, 239
SsiI CCGC 2 cut(s) 34, 232
SspI AATATT 1 cut(s) 268
StyD4I CCNGG 1 cut(s) 117
TaqI TCGA 2 cut(s) 45, 107
TasI AATT 3 cut(s) 47, 193, 239
TauI GCSGC 1 cut(s) 36
Tru1I TTAA 4 cut(s) 228, 243, 372, 420
Tru9I TTAA 4 cut(s) 228, 243, 372, 420
TspDTI ATGAA 4 cut(s) 206, 251, 324, 351
TspGWI ACGGA 1 cut(s) 362
XapI RAATTY 3 cut(s) 47, 193, 239
Zsp2I ATGCAT 2 cut(s) 214, 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.