pycom12g22340

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr12
Physical Location & Seq
Forward (+)
23270232 .. 23270961
730 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom12g22340.1

Sequence Viewer

Length: 339 bp
ATGTCAAATCACACCAGTGCTAGTTCAGAAGTTGAGAAGAAAAATCCAAAAGTAGAGGCACAACTTAAAAAAGCAAAGGGGACAGAAAATCTGGGTGACAATGATGCATTTTCCGACTACATTAGTCGCACAAAAATTAAGATCAGAGCTGTATCCAATGTTGGTATGGAAAATATTGCCTCTGGATCAACAGGTGATGGATATGATTCAAAAAATGAAGACGACGTGAAAGATACGTTTTCAGATTATATAAATCGTGCGAAGATGAGGATCAGAAAGACATCAAGTATTGGAAGCAGAAAGGTTATCTCCTTCAAACAAGAGCAATTAGTAGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

113

Amino Acids

12.42

Weight (kDa)

9.13

Isoelectric Point (pI)

30.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 193, 278
AgsI TTSAA 2 cut(s) 210, 316
AjiI CACGTC 1 cut(s) 226
AleI CACNNNNGTG 1 cut(s) 15
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
AlwI GGATC 2 cut(s) 193, 278
AsuHPI GGTGA 2 cut(s) 107, 206
BbsI GAAGAC 1 cut(s) 225
BccI CCATC 1 cut(s) 191
BciVI GTATCC 1 cut(s) 163
BfaI CTAG 1 cut(s) 21
BfuI GTATCC 1 cut(s) 163
BmgBI CACGTC 1 cut(s) 226
BmsI GCATC 1 cut(s) 94
BpiI GAAGAC 1 cut(s) 225
BsaBI GATNNNNATC 1 cut(s) 269
Bse1I ACTGG 1 cut(s) 15
Bse8I GATNNNNATC 1 cut(s) 269
BseJI GATNNNNATC 1 cut(s) 269
BseNI ACTGG 1 cut(s) 15
BslFI GGGAC 1 cut(s) 94
BsmFI GGGAC 1 cut(s) 94
Bsp143I GATC 3 cut(s) 141, 185, 270
BspPI GGATC 2 cut(s) 193, 278
BsrI ACTGG 1 cut(s) 15
BssMI GATC 3 cut(s) 141, 185, 270
BstKTI GATC 3 cut(s) 144, 188, 273
BstMBI GATC 3 cut(s) 141, 185, 270
BstV2I GAAGAC 1 cut(s) 225
BsuI GTATCC 1 cut(s) 163
BtrI CACGTC 1 cut(s) 226
BtsIMutI CAGTG 1 cut(s) 22
CviJI RGCY 1 cut(s) 149
CviKI_1 RGCY 1 cut(s) 149
DpnI GATC 3 cut(s) 143, 187, 272
DpnII GATC 3 cut(s) 141, 185, 270
EcoT22I ATGCAT 1 cut(s) 109
FaiI YATR 4 cut(s) 167, 204, 249, 251
FaqI GGGAC 1 cut(s) 94
FspBI CTAG 1 cut(s) 21
HinfI GANTC 1 cut(s) 206
HphI GGTGA 2 cut(s) 107, 206
Hpy188I TCNGA 5 cut(s) 28, 115, 146, 244, 275
Hpy188III TCNNGA 1 cut(s) 183
Hpy99I CGWCG 1 cut(s) 227
HpyAV CCTTC 1 cut(s) 322
HpyCH4IV ACGT 2 cut(s) 225, 236
HpyCH4V TGCA 1 cut(s) 107
HpySE526I ACGT 2 cut(s) 225, 236
Kzo9I GATC 3 cut(s) 141, 185, 270
LpnPI CCDG 4 cut(s) 28, 77, 168, 177
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 21
MaeII ACGT 2 cut(s) 225, 236
MaeIII GTNAC 1 cut(s) 95
MalI GATC 3 cut(s) 143, 187, 272
MboI GATC 3 cut(s) 141, 185, 270
MboII GAAGA 3 cut(s) 49, 230, 274
MluCI AATT 2 cut(s) 135, 326
MmeI TCCRAC 1 cut(s) 138
MnlI CCTC 3 cut(s) 49, 190, 261
Mph1103I ATGCAT 1 cut(s) 109
MseI TTAA 2 cut(s) 66, 138
MslI CAYNNNNRTG 1 cut(s) 15
NdeII GATC 3 cut(s) 141, 185, 270
NmuCI GTSAC 1 cut(s) 95
NsiI ATGCAT 1 cut(s) 109
OliI CACNNNNGTG 1 cut(s) 15
PfeI GAWTC 1 cut(s) 206
RseI CAYNNNNRTG 1 cut(s) 15
SaqAI TTAA 2 cut(s) 66, 138
Sau3AI GATC 3 cut(s) 141, 185, 270
SetI ASST 5 cut(s) 151, 196, 228, 239, 306
SfaNI GCATC 1 cut(s) 94
SgeI CNNG 9 cut(s) 27, 33, 104, 195, 204, 238, 269, 297, 332
SmiMI CAYNNNNRTG 1 cut(s) 15
Sse9I AATT 2 cut(s) 135, 326
SspI AATATT 1 cut(s) 175
SspMI CTAG 1 cut(s) 21
TaiI ACGT 2 cut(s) 228, 239
TasI AATT 2 cut(s) 135, 326
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 2 cut(s) 66, 138
Tru9I TTAA 2 cut(s) 66, 138
TscAI CASTG 1 cut(s) 22
TseFI GTSAC 1 cut(s) 95
Tsp45I GTSAC 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 231
TspRI CASTG 1 cut(s) 22
XcmI CCANNNNNNNNNTGG 1 cut(s) 163
XspI CTAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.