RLG00000025731

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr5
Physical Location & Seq
Forward (+)
47936486 .. 47936848
363 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000025731

Sequence Viewer

Length: 363 bp
ATGACTACACAAACAAAGGTTGCCGCTGATCCGAGTAATGGCAGGGCCAATATAAAAGTTGACAAGAAGCAAGAGCGGCCCAAATTAGAGGCAAAACTTACAAAAGGAGGTAGGACAACAAGCCTTAAGGGTTACAATGATGCATTTTCTGACTACATTACTCGTGCAAAAATTAGGATTAGAGCTATGTCAAGTGTTGGCATTGAAAAGATTGCCTCTGGATCAGCAGATGATGTGTATGATACAAAGAAAGAAGATAGCACCAAAGATACATTTTCAGTTTATATCAATCGTGCTAAGATGAAGATCAGAAAAACGTCTAGTATTGGAAGCAGAAAGATCATCTCCTTCAAACGAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.4

Weight (kDa)

10.15

Isoelectric Point (pI)

24.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 76
AciI CCGC 2 cut(s) 24, 76
AclWI GGATC 2 cut(s) 23, 229
AfiI CCNNNNNNNGG 1 cut(s) 38
AflII CTTAAG 1 cut(s) 125
AgsI TTSAA 2 cut(s) 206, 352
AluBI AGCT 1 cut(s) 185
AluI AGCT 1 cut(s) 185
AlwI GGATC 2 cut(s) 23, 229
AoxI GGCC 2 cut(s) 45, 77
AspS9I GGNCC 2 cut(s) 45, 78
BauI CACGAG 1 cut(s) 162
BfaI CTAG 1 cut(s) 321
BfrI CTTAAG 1 cut(s) 125
BisI GCNGC 2 cut(s) 24, 77
BlsI GCNGC 2 cut(s) 25, 78
BmgT120I GGNCC 2 cut(s) 45, 78
BmsI GCATC 1 cut(s) 130
BsaBI GATNNNNATC 1 cut(s) 305
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse8I GATNNNNATC 1 cut(s) 305
BseJI GATNNNNATC 1 cut(s) 305
BseLI CCNNNNNNNGG 1 cut(s) 38
BshFI GGCC 2 cut(s) 47, 79
BslI CCNNNNNNNGG 1 cut(s) 38
BsnI GGCC 2 cut(s) 47, 79
Bsp143I GATC 4 cut(s) 28, 221, 306, 339
BspACI CCGC 2 cut(s) 24, 76
BspANI GGCC 2 cut(s) 47, 79
BspPI GGATC 2 cut(s) 23, 229
BspTI CTTAAG 1 cut(s) 125
BsrBI CCGCTC 1 cut(s) 76
BssMI GATC 4 cut(s) 28, 221, 306, 339
BssSI CACGAG 1 cut(s) 162
Bst2BI CACGAG 1 cut(s) 162
BstAFI CTTAAG 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 297
BstKTI GATC 4 cut(s) 31, 224, 309, 342
BstMBI GATC 4 cut(s) 28, 221, 306, 339
BstMWI GCNNNNNNNGC 1 cut(s) 76
BsuRI GGCC 2 cut(s) 47, 79
Cfr13I GGNCC 2 cut(s) 45, 78
CviJI RGCY 4 cut(s) 47, 79, 123, 185
CviKI_1 RGCY 4 cut(s) 47, 79, 123, 185
DdeI CTNAG 1 cut(s) 297
DpnI GATC 4 cut(s) 30, 223, 308, 341
DpnII GATC 4 cut(s) 28, 221, 306, 339
EcoT22I ATGCAT 1 cut(s) 145
FaiI YATR 4 cut(s) 53, 188, 240, 285
Fnu4HI GCNGC 2 cut(s) 24, 77
Fsp4HI GCNGC 2 cut(s) 24, 77
FspBI CTAG 1 cut(s) 321
GluI GCNGC 2 cut(s) 24, 77
HaeIII GGCC 2 cut(s) 47, 79
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
Hpy166II GTNNAC 1 cut(s) 61
Hpy188I TCNGA 3 cut(s) 33, 151, 311
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 358
HpyCH4IV ACGT 1 cut(s) 317
HpyCH4V TGCA 2 cut(s) 143, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 297
HpySE526I ACGT 1 cut(s) 317
Kzo9I GATC 4 cut(s) 28, 221, 306, 339
LpnPI CCDG 2 cut(s) 28, 204
LweI GCATC 1 cut(s) 130
MaeI CTAG 1 cut(s) 321
MaeII ACGT 1 cut(s) 317
MaeIII GTNAC 1 cut(s) 131
MalI GATC 4 cut(s) 30, 223, 308, 341
MbiI CCGCTC 1 cut(s) 76
MboI GATC 4 cut(s) 28, 221, 306, 339
MboII GAAGA 2 cut(s) 266, 316
MluCI AATT 2 cut(s) 83, 171
MnlI CCTC 3 cut(s) 82, 101, 226
Mph1103I ATGCAT 1 cut(s) 145
MseI TTAA 1 cut(s) 126
MspA1I CMGCKG 1 cut(s) 26
MspCI CTTAAG 1 cut(s) 125
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeII GATC 4 cut(s) 28, 221, 306, 339
NsiI ATGCAT 1 cut(s) 145
PkrI GCNGC 2 cut(s) 25, 78
PspPI GGNCC 2 cut(s) 45, 78
SaqAI TTAA 1 cut(s) 126
SatI GCNGC 2 cut(s) 24, 77
Sau3AI GATC 4 cut(s) 28, 221, 306, 339
Sau96I GGNCC 2 cut(s) 45, 78
SetI ASST 4 cut(s) 21, 112, 187, 320
SfaNI GCATC 1 cut(s) 130
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 2 cut(s) 83, 171
SsiI CCGC 2 cut(s) 24, 76
SspMI CTAG 1 cut(s) 321
TaiI ACGT 1 cut(s) 320
TasI AATT 2 cut(s) 83, 171
TauI GCSGC 2 cut(s) 26, 79
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TspDTI ATGAA 1 cut(s) 317
Vha464I CTTAAG 1 cut(s) 125
XspI CTAG 1 cut(s) 321
Zsp2I ATGCAT 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.