Rh3DG028700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
1909466 .. 1910679
1214 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG028700.1

Sequence Viewer

Length: 177 bp
ATGTCAAGTGTTGGCATTGAAAAGATTGCCTCTGGATCCGCAGATGCTGTGTATGATACGAAGAAAGAAGATAGCACCAAAGATACATTTTCAGTTTATATCAATCGTGCTGAGATGAAGATCAGAAAAACGTCGAGTATTGGAAGCAGAAAGATCATCTCCTTCAAACGAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.46

Weight (kDa)

9.63

Isoelectric Point (pI)

34.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 39
AclWI GGATC 2 cut(s) 30, 43
AgsI TTSAA 2 cut(s) 20, 166
AlwI GGATC 2 cut(s) 30, 43
AlwNI CAGNNNCTG 1 cut(s) 47
BamHI GGATCC 1 cut(s) 35
BmiI GGNNCC 1 cut(s) 37
BmsI GCATC 1 cut(s) 34
BsaBI GATNNNNATC 1 cut(s) 119
Bse8I GATNNNNATC 1 cut(s) 119
BseJI GATNNNNATC 1 cut(s) 119
BseMII CTCAG 1 cut(s) 102
Bsp143I GATC 3 cut(s) 35, 120, 153
BspACI CCGC 1 cut(s) 39
BspCNI CTCAG 1 cut(s) 103
BspLI GGNNCC 1 cut(s) 37
BspPI GGATC 2 cut(s) 30, 43
BssMI GATC 3 cut(s) 35, 120, 153
BstDEI CTNAG 1 cut(s) 111
BstKTI GATC 3 cut(s) 38, 123, 156
BstMBI GATC 3 cut(s) 35, 120, 153
BstX2I RGATCY 1 cut(s) 35
BstYI RGATCY 1 cut(s) 35
CaiI CAGNNNCTG 1 cut(s) 47
DdeI CTNAG 1 cut(s) 111
DpnI GATC 3 cut(s) 37, 122, 155
DpnII GATC 3 cut(s) 35, 120, 153
FaiI YATR 2 cut(s) 54, 99
FspEI CC 5 cut(s) 18, 43, 52, 91, 126
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 33
Hpy99I CGWCG 1 cut(s) 136
HpyAV CCTTC 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 131
HpyF3I CTNAG 1 cut(s) 111
HpySE526I ACGT 1 cut(s) 131
Kzo9I GATC 3 cut(s) 35, 120, 153
LpnPI CCDG 1 cut(s) 18
LweI GCATC 1 cut(s) 34
MaeII ACGT 1 cut(s) 131
MalI GATC 3 cut(s) 37, 122, 155
MboI GATC 3 cut(s) 35, 120, 153
MboII GAAGA 3 cut(s) 73, 80, 130
MflI RGATCY 1 cut(s) 35
MnlI CCTC 1 cut(s) 40
NdeII GATC 3 cut(s) 35, 120, 153
NlaIV GGNNCC 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 37
PstNI CAGNNNCTG 1 cut(s) 47
PsuI RGATCY 1 cut(s) 35
Sau3AI GATC 3 cut(s) 35, 120, 153
SetI ASST 1 cut(s) 134
SfaNI GCATC 1 cut(s) 34
SgeI CNNG 4 cut(s) 18, 45, 119, 147
SsiI CCGC 1 cut(s) 39
TaiI ACGT 1 cut(s) 134
TaqI TCGA 1 cut(s) 134
TspDTI ATGAA 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.