Rh3BG028800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
1910045 .. 1918132
8088 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG028800.1

Sequence Viewer

Length: 339 bp
ATGAAACATGTTGTGCTCTTAGCACCCTTGTTGAGATACGCTTCCCAAATACCATTTGGTGCTCCATCTAGTAGTTCCCTGACTTCCCTTCTCCCAAATATAATCAATTGGCTCTTCTCGATGAGGTGCTTCAACAACGAACTGAAGTCTTTGATCAGAGCTATGTCAAGTGTTGGCATTGAAAAGATTGCCTCTGGATCCGCAGATGCTGTGTATGATACGAAGAAAGAAGATAGCACCAAAGATACATTTTCAGTTTATATCAATCGTGCTGAGATGAAGATCAGAAAAACGTCGAGTATTGGAAGCAGAAAGATCATCTCCTTCAAACGAGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.5

Weight (kDa)

9.94

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 201
AclWI GGATC 2 cut(s) 192, 205
AcuI CTGAAG 1 cut(s) 164
AflIII ACRYGT 1 cut(s) 7
AgsI TTSAA 3 cut(s) 133, 182, 328
AluBI AGCT 1 cut(s) 161
AluI AGCT 1 cut(s) 161
Alw21I GWGCWC 2 cut(s) 18, 64
AlwI GGATC 2 cut(s) 192, 205
AlwNI CAGNNNCTG 1 cut(s) 209
BamHI GGATCC 1 cut(s) 197
Bbv12I GWGCWC 2 cut(s) 18, 64
BccI CCATC 1 cut(s) 73
BclI TGATCA 1 cut(s) 153
BfaI CTAG 1 cut(s) 69
BmiI GGNNCC 1 cut(s) 199
BmsI GCATC 1 cut(s) 196
BsaBI GATNNNNATC 1 cut(s) 281
Bse8I GATNNNNATC 1 cut(s) 281
BseJI GATNNNNATC 1 cut(s) 281
BseMII CTCAG 1 cut(s) 264
BsiHKAI GWGCWC 2 cut(s) 18, 64
Bsp1286I GDGCHC 2 cut(s) 18, 64
Bsp143I GATC 4 cut(s) 153, 197, 282, 315
BspACI CCGC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 265
BspLI GGNNCC 1 cut(s) 199
BspPI GGATC 2 cut(s) 192, 205
BspQI GCTCTTC 1 cut(s) 119
BssMI GATC 4 cut(s) 153, 197, 282, 315
Bst6I CTCTTC 1 cut(s) 119
BstDEI CTNAG 2 cut(s) 19, 273
BstKTI GATC 4 cut(s) 156, 200, 285, 318
BstMBI GATC 4 cut(s) 153, 197, 282, 315
BstNSI RCATGY 1 cut(s) 11
BstX2I RGATCY 1 cut(s) 197
BstYI RGATCY 1 cut(s) 197
CaiI CAGNNNCTG 1 cut(s) 209
CviAII CATG 1 cut(s) 8
CviJI RGCY 2 cut(s) 112, 161
CviKI_1 RGCY 2 cut(s) 112, 161
DdeI CTNAG 2 cut(s) 19, 273
DpnI GATC 4 cut(s) 155, 199, 284, 317
DpnII GATC 4 cut(s) 153, 197, 282, 315
Eam1104I CTCTTC 1 cut(s) 119
EarI CTCTTC 1 cut(s) 119
Eco57I CTGAAG 1 cut(s) 164
FaeI CATG 1 cut(s) 11
FaiI YATR 5 cut(s) 9, 101, 164, 216, 261
FatI CATG 1 cut(s) 7
FbaI TGATCA 1 cut(s) 153
FspBI CTAG 1 cut(s) 69
Hin1II CATG 1 cut(s) 11
Hpy188I TCNGA 2 cut(s) 158, 287
Hpy188III TCNNGA 2 cut(s) 118, 195
Hpy99I CGWCG 1 cut(s) 298
HpyAV CCTTC 2 cut(s) 98, 334
HpyCH4IV ACGT 1 cut(s) 293
HpyF3I CTNAG 2 cut(s) 19, 273
HpySE526I ACGT 1 cut(s) 293
Hsp92II CATG 1 cut(s) 11
Ksp22I TGATCA 1 cut(s) 153
Kzo9I GATC 4 cut(s) 153, 197, 282, 315
LguI GCTCTTC 1 cut(s) 119
LmnI GCTCC 1 cut(s) 67
LpnPI CCDG 2 cut(s) 92, 180
LweI GCATC 1 cut(s) 196
MaeI CTAG 1 cut(s) 69
MaeII ACGT 1 cut(s) 293
MalI GATC 4 cut(s) 155, 199, 284, 317
MboI GATC 4 cut(s) 153, 197, 282, 315
MboII GAAGA 4 cut(s) 106, 235, 242, 292
MfeI CAATTG 1 cut(s) 106
MflI RGATCY 1 cut(s) 197
MhlI GDGCHC 2 cut(s) 18, 64
MluCI AATT 1 cut(s) 106
MnlI CCTC 2 cut(s) 117, 202
MunI CAATTG 1 cut(s) 106
NdeII GATC 4 cut(s) 153, 197, 282, 315
NlaIII CATG 1 cut(s) 11
NlaIV GGNNCC 1 cut(s) 199
NspI RCATGY 1 cut(s) 11
PciI ACATGT 1 cut(s) 7
PciSI GCTCTTC 1 cut(s) 119
PscI ACATGT 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 199
PstNI CAGNNNCTG 1 cut(s) 209
PsuI RGATCY 1 cut(s) 197
SapI GCTCTTC 1 cut(s) 119
Sau3AI GATC 4 cut(s) 153, 197, 282, 315
SduI GDGCHC 2 cut(s) 18, 64
SetI ASST 3 cut(s) 128, 163, 296
SfaNI GCATC 1 cut(s) 196
SgeI CNNG 9 cut(s) 20, 40, 81, 91, 130, 180, 207, 281, 309
Sse9I AATT 1 cut(s) 106
SsiI CCGC 1 cut(s) 201
SspMI CTAG 1 cut(s) 69
TaiI ACGT 1 cut(s) 296
TaqI TCGA 2 cut(s) 119, 296
TasI AATT 1 cut(s) 106
TspDTI ATGAA 2 cut(s) 17, 293
XceI RCATGY 1 cut(s) 11
XcmI CCANNNNNNNNNTGG 1 cut(s) 53
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.