Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8255291.1

Orthogroup ID

OG0005172

Physical Location & Seq

Genomic Coordinates Forward (+)

162 .. 653

Gene Structure 492 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8255291.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 492 bp

atggaaaatggtcatgacggatcaaactccaagggtatgtgtgagaagatcttcagctgtctctgcccaaattttcaatcaaaccatcatgcacaccacaaactagccaatgggtccggagctgaagctttggcgaatgatatggcaagagtgcccaaggcagagatggttcgacctacaagggtttatgggcaaagacaacatcatgttattgtgagcatggattcacaagttgaggtagataacaagacaccaggtttggataaaaatgatacattttctgaatacattaaccgcacaaaatttaagatcagagcttctaagtccaatgtgggaaaggagaaggttgcctccggagaagatcatgttaaagaaaaagagaaggaagatgatggtaaggatgtattttcagattttgttaatcgcgctaagattaagattaggaagacatcaagttttggaagcaaaatgaatatctcctttaagaattag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

GIDE zf-C3HC4_3

Protein Analysis

163

Amino Acids

18.27

Weight (kDa)

9.22

Isoelectric Point (pI)

19.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005172)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g07512 FvH4_6g02570
prunus_persica	Prupe.6G345800_v2.0.a1
pyrus_communis	pycom04g20040 pycom04g20050 pycom04g20060 pycom12g22310 pycom12g22320 pycom12g22330 pycom12g22340
rosa_chinensis	RchiOBHm_Chr3g0450471
rosa_laevigata	RLG00000025728 RLG00000025731
rosa_multiflora	Rmu_co8255291.1_g000001 Rmu_sc0000330.1_g000012 Rmu_sc0005951.1_g000003 Rmu_sc0005951.1_g000005
rosa_roxburghii	Rroxscaffold_6G00428140 Rroxscaffold_6G00428160
rosa_rugosa	Rorug02G0627900 Rorug02G0628000
rosa_samantha	Rh3AG028300 Rh3AG028600 Rh3BG028800 Rh3BG029100 Rh3CG027600 Rh3CG027900 Rh3DG028700 Rh3DG028800
rosa_wichuraiana	Rw3G002190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	426
AccIII	TCCGGA	2 cut(s)	116, 353
AciI	CCGC	1 cut(s)	295
AclWI	GGATC	1 cut(s)	28
AcsI	RAATTY	2 cut(s)	70, 302
AcuI	CTGAAG	2 cut(s)	37, 144
AgsI	TTSAA	1 cut(s)	77
AjnI	CCWGG	1 cut(s)	253
AluBI	AGCT	4 cut(s)	57, 122, 128, 317
AluI	AGCT	4 cut(s)	57, 122, 128, 317
Alw26I	GTCTC	1 cut(s)	65
AlwI	GGATC	1 cut(s)	28
Aor13HI	TCCGGA	2 cut(s)	116, 353
ApoI	RAATTY	2 cut(s)	70, 302
ArsI	GACNNNNNNTTYG	2 cut(s)	241, 273
Asp700I	GAANNNNTTC	1 cut(s)	50
AspLEI	GCGC	1 cut(s)	428
AspS9I	GGNCC	1 cut(s)	114
AvaII	GGWCC	1 cut(s)	114
BaeGI	GKGCMC	1 cut(s)	156
BbsI	GAAGAC	1 cut(s)	452
BccI	CCATC	3 cut(s)	93, 160, 386
BciT130I	CCWGG	1 cut(s)	255
BcoDI	GTCTC	1 cut(s)	65
BfaI	CTAG	1 cut(s)	104
BglII	AGATCT	1 cut(s)	48
Bme1390I	CCNGG	1 cut(s)	255
Bme18I	GGWCC	1 cut(s)	114
BmgT120I	GGNCC	1 cut(s)	114
BmiI	GGNNCC	1 cut(s)	115
BmrFI	CCNGG	1 cut(s)	255
BpiI	GAAGAC	1 cut(s)	452
BsaJI	CCNNGG	2 cut(s)	30, 156
BsaWI	WCCGGW	2 cut(s)	116, 353
BseAI	TCCGGA	2 cut(s)	116, 353
BseBI	CCWGG	1 cut(s)	255
BseDI	CCNNGG	2 cut(s)	30, 156
BseGI	GGATG	1 cut(s)	406
BseSI	GKGCMC	1 cut(s)	156
Bsh1236I	CGCG	1 cut(s)	426
BsiSI	CCGG	2 cut(s)	117, 354
BsmAI	GTCTC	1 cut(s)	65
Bsp1286I	GDGCHC	1 cut(s)	156
Bsp13I	TCCGGA	2 cut(s)	116, 353
Bsp143I	GATC	4 cut(s)	20, 48, 309, 361
BspACI	CCGC	1 cut(s)	295
BspEI	TCCGGA	2 cut(s)	116, 353
BspFNI	CGCG	1 cut(s)	426
BspHI	TCATGA	1 cut(s)	13
BspLI	GGNNCC	1 cut(s)	115
BspPI	GGATC	1 cut(s)	28
BssECI	CCNNGG	2 cut(s)	30, 156
BssMI	GATC	4 cut(s)	20, 48, 309, 361
BssT1I	CCWWGG	2 cut(s)	30, 156
Bst2UI	CCWGG	1 cut(s)	255
BstDEI	CTNAG	2 cut(s)	321, 429
BstF5I	GGATG	1 cut(s)	406
BstFNI	CGCG	1 cut(s)	426
BstHHI	GCGC	1 cut(s)	428
BstKTI	GATC	4 cut(s)	23, 51, 312, 364
BstMAI	GTCTC	1 cut(s)	65
BstMBI	GATC	4 cut(s)	20, 48, 309, 361
BstMWI	GCNNNNNNNGC	1 cut(s)	63
BstNI	CCWGG	1 cut(s)	255
BstSCI	CCNGG	1 cut(s)	253
BstSLI	GKGCMC	1 cut(s)	156
BstUI	CGCG	1 cut(s)	426
BstV2I	GAAGAC	1 cut(s)	452
BstX2I	RGATCY	1 cut(s)	48
BstYI	RGATCY	1 cut(s)	48
BtsCI	GGATG	1 cut(s)	406
CciI	TCATGA	1 cut(s)	13
CfoI	GCGC	1 cut(s)	428
Cfr13I	GGNCC	1 cut(s)	114
CsiI	ACCWGGT	1 cut(s)	253
CviAII	CATG	5 cut(s)	14, 89, 206, 220, 365
CviJI	RGCY	5 cut(s)	57, 107, 122, 128, 317
CviKI_1	RGCY	5 cut(s)	57, 107, 122, 128, 317
DdeI	CTNAG	2 cut(s)	321, 429
DpnI	GATC	4 cut(s)	22, 50, 311, 363
DpnII	GATC	4 cut(s)	20, 48, 309, 361
Eco130I	CCWWGG	2 cut(s)	30, 156
Eco47I	GGWCC	1 cut(s)	114
Eco57I	CTGAAG	2 cut(s)	37, 144
EcoRII	CCWGG	1 cut(s)	253
EcoT14I	CCWWGG	2 cut(s)	30, 156
ErhI	CCWWGG	2 cut(s)	30, 156
FaeI	CATG	5 cut(s)	17, 92, 209, 223, 368
FaiI	YATR	8 cut(s)	15, 38, 90, 143, 189, 207, 221, 366
FatI	CATG	5 cut(s)	13, 88, 205, 219, 364
FokI	GGATG	1 cut(s)	413
FspBI	CTAG	1 cut(s)	104
GlaI	GCGC	1 cut(s)	427
HapII	CCGG	2 cut(s)	117, 354
HhaI	GCGC	1 cut(s)	428
Hin1II	CATG	5 cut(s)	17, 92, 209, 223, 368
Hin6I	GCGC	1 cut(s)	426
HinP1I	GCGC	1 cut(s)	426
HindIII	AAGCTT	1 cut(s)	126
HinfI	GANTC	1 cut(s)	224
HpaII	CCGG	2 cut(s)	117, 354
Hpy188I	TCNGA	3 cut(s)	283, 314, 412
Hpy188III	TCNNGA	3 cut(s)	14, 117, 354
HpyAV	CCTTC	2 cut(s)	337, 376
HpyCH4V	TGCA	1 cut(s)	92
HpyF10VI	GCNNNNNNNGC	1 cut(s)	63
HpyF3I	CTNAG	2 cut(s)	321, 429
Hsp92II	CATG	5 cut(s)	17, 92, 209, 223, 368
HspAI	GCGC	1 cut(s)	426
Kpn2I	TCCGGA	2 cut(s)	116, 353
Kzo9I	GATC	4 cut(s)	20, 48, 309, 361
LmnI	GCTCC	1 cut(s)	119
LpnPI	CCDG	4 cut(s)	130, 240, 267, 367
MabI	ACCWGGT	1 cut(s)	253
MaeI	CTAG	1 cut(s)	104
MalI	GATC	4 cut(s)	22, 50, 311, 363
MboI	GATC	4 cut(s)	20, 48, 309, 361
MboII	GAAGA	5 cut(s)	43, 58, 371, 398, 457
MflI	RGATCY	1 cut(s)	48
MhlI	GDGCHC	1 cut(s)	156
MluCI	AATT	3 cut(s)	70, 302, 487
MnlI	CCTC	2 cut(s)	229, 361
MroI	TCCGGA	2 cut(s)	116, 353
MroXI	GAANNNNTTC	1 cut(s)	50
MseI	TTAA	6 cut(s)	291, 306, 369, 420, 435, 483
MspA1I	CMGCKG	1 cut(s)	57
MspI	CCGG	2 cut(s)	117, 354
MspR9I	CCNGG	1 cut(s)	255
MvaI	CCWGG	1 cut(s)	255
MvnI	CGCG	1 cut(s)	426
MwoI	GCNNNNNNNGC	1 cut(s)	63
NdeII	GATC	4 cut(s)	20, 48, 309, 361
NlaIII	CATG	5 cut(s)	17, 92, 209, 223, 368
NlaIV	GGNNCC	1 cut(s)	115
PagI	TCATGA	1 cut(s)	13
PdmI	GAANNNNTTC	1 cut(s)	50
PfeI	GAWTC	1 cut(s)	224
Psp6I	CCWGG	1 cut(s)	253
PspGI	CCWGG	1 cut(s)	253
PspN4I	GGNNCC	1 cut(s)	115
PspPI	GGNCC	1 cut(s)	114
PsuI	RGATCY	1 cut(s)	48
PvuII	CAGCTG	1 cut(s)	57
SaqAI	TTAA	6 cut(s)	291, 306, 369, 420, 435, 483
Sau3AI	GATC	4 cut(s)	20, 48, 309, 361
Sau96I	GGNCC	1 cut(s)	114
ScrFI	CCNGG	1 cut(s)	255
SduI	GDGCHC	1 cut(s)	156
SetI	ASST	8 cut(s)	59, 124, 130, 178, 240, 259, 319, 348
SexAI	ACCWGGT	1 cut(s)	253
SinI	GGWCC	1 cut(s)	114
Sse9I	AATT	3 cut(s)	70, 302, 487
SsiI	CCGC	1 cut(s)	295
SspMI	CTAG	1 cut(s)	104
StyD4I	CCNGG	1 cut(s)	253
StyI	CCWWGG	2 cut(s)	30, 156
TaqI	TCGA	1 cut(s)	172
TasI	AATT	3 cut(s)	70, 302, 487
TfiI	GAWTC	1 cut(s)	224
Tru1I	TTAA	6 cut(s)	291, 306, 369, 420, 435, 483
Tru9I	TTAA	6 cut(s)	291, 306, 369, 420, 435, 483
TspDTI	ATGAA	1 cut(s)	485
TspGWI	ACGGA	1 cut(s)	33
VpaK11BI	GGWCC	1 cut(s)	114
XapI	RAATTY	2 cut(s)	70, 302
XcmI	CCANNNNNNNNNTGG	1 cut(s)	163
XmnI	GAANNNNTTC	1 cut(s)	50
XspI	CTAG	1 cut(s)	104

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.