pycom15g34560

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
34354592 .. 34355149
558 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 558 bp
ATGGTGCGCAAACGGGGCTTTTACCCAGCTTTCACCCAGCTTTCATGGTGGTTGTGGAGTGGAAAGCAAAAAGAGCCTAGAATCCCAAAGGGGTCCTCTTTAAATTCTTCCCCTGACTCGGGCATGCGGGAAACTGATGCGTTAAAGTTTCCTTCGGTGAAGGGGTCAAATATGGCCTCATCATCGTCGAGAAGGGTGAAACGCAAATGGCATAGTCGGGAAGAACGGAAAATTGATAAGGAATATGATGTCGTTCTTGTGCCATCCGAGGGTGGATGTGTTTCCGGTTCTGAGTCCGAGGCCTCGGATTGGGCAGTTGGATGGTTCGAGCCTGTTGGACCTGGGTTACAGAGAGATGACGATGCAGACGATAGTTTTGCCGTGCTGGTTCCATGCTATGGGCATGTTATTCATGATATGGTGAAGGATTCCAAGAACAATATCTTGAGCACAGTTGGGAACATCCCAGATGGTTATTCAGATGGTAAGAGCTTATGTCTTATACGCCTATTTATCTCTTTGCTTTCATTTCATGTGTCCTGCTCATATGATGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

186

Amino Acids

20.57

Weight (kDa)

6.9

Isoelectric Point (pI)

55.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 8
AccB7I CCANNNNNTGG 1 cut(s) 398
AciI CCGC 1 cut(s) 127
AcsI RAATTY 1 cut(s) 103
AfiI CCNNNNNNNGG 5 cut(s) 118, 119, 269, 309, 398
AjnI CCWGG 1 cut(s) 340
AluBI AGCT 3 cut(s) 29, 40, 492
AluI AGCT 3 cut(s) 29, 40, 492
Alw21I GWGCWC 1 cut(s) 452
Ama87I CYCGRG 1 cut(s) 118
AoxI GGCC 2 cut(s) 174, 300
ApoI RAATTY 1 cut(s) 103
ArsI GACNNNNNNTTYG 2 cut(s) 359, 391
AspLEI GCGC 1 cut(s) 9
AspS9I GGNCC 2 cut(s) 93, 338
AsuHPI GGTGA 4 cut(s) 25, 169, 208, 433
AvaI CYCGRG 1 cut(s) 118
AvaII GGWCC 2 cut(s) 93, 338
Bbv12I GWGCWC 1 cut(s) 452
BccI CCATC 5 cut(s) 271, 315, 464, 476, 545
BceAI ACGGC 1 cut(s) 365
BcgI CGANNNNNNTGC 2 cut(s) 359, 393
BciT130I CCWGG 1 cut(s) 342
BfaI CTAG 1 cut(s) 78
Bme1390I CCNGG 1 cut(s) 342
Bme18I GGWCC 2 cut(s) 93, 338
BmeT110I CYCGRG 1 cut(s) 118
BmgT120I GGNCC 2 cut(s) 93, 338
BmiI GGNNCC 2 cut(s) 94, 390
BmrFI CCNGG 1 cut(s) 342
BmsI GCATC 2 cut(s) 127, 352
BpuEI CTTGAG 1 cut(s) 466
BsaJI CCNNGG 4 cut(s) 267, 297, 303, 341
BsaWI WCCGGW 1 cut(s) 284
Bsc4I CCNNNNNNNGG 5 cut(s) 118, 119, 269, 309, 398
BseBI CCWGG 1 cut(s) 342
BseDI CCNNGG 4 cut(s) 267, 297, 303, 341
BseGI GGATG 4 cut(s) 263, 281, 326, 462
BseLI CCNNNNNNNGG 5 cut(s) 118, 119, 269, 309, 398
BseMII CTCAG 1 cut(s) 282
BseYI CCCAGC 2 cut(s) 25, 36
BshFI GGCC 2 cut(s) 176, 302
BsiHKAI GWGCWC 1 cut(s) 452
BsiHKCI CYCGRG 1 cut(s) 118
BsiSI CCGG 1 cut(s) 285
BslI CCNNNNNNNGG 5 cut(s) 118, 119, 269, 309, 398
BsnI GGCC 2 cut(s) 176, 302
BsoBI CYCGRG 1 cut(s) 118
Bsp1286I GDGCHC 1 cut(s) 452
BspACI CCGC 1 cut(s) 127
BspANI GGCC 2 cut(s) 176, 302
BspCNI CTCAG 1 cut(s) 283
BspHI TCATGA 1 cut(s) 412
BspLI GGNNCC 2 cut(s) 94, 390
BssECI CCNNGG 4 cut(s) 267, 297, 303, 341
Bst2UI CCWGG 1 cut(s) 342
Bst4CI ACNGT 1 cut(s) 454
BstC8I GCNNGC 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 291
BstF5I GGATG 4 cut(s) 263, 281, 326, 462
BstHHI GCGC 1 cut(s) 9
BstMWI GCNNNNNNNGC 2 cut(s) 15, 73
BstNI CCWGG 1 cut(s) 342
BstNSI RCATGY 2 cut(s) 127, 407
BstSCI CCNGG 1 cut(s) 340
BsuRI GGCC 2 cut(s) 176, 302
BtsCI GGATG 4 cut(s) 263, 281, 326, 462
Cac8I GCNNGC 1 cut(s) 125
CciI TCATGA 1 cut(s) 412
CfoI GCGC 1 cut(s) 9
Cfr13I GGNCC 2 cut(s) 93, 338
CviAII CATG 6 cut(s) 45, 124, 393, 404, 413, 533
CviJI RGCY 8 cut(s) 18, 29, 40, 76, 176, 302, 331, 492
CviKI_1 RGCY 8 cut(s) 18, 29, 40, 76, 176, 302, 331, 492
DdeI CTNAG 1 cut(s) 291
DraI TTTAAA 1 cut(s) 102
Eco147I AGGCCT 1 cut(s) 302
Eco47I GGWCC 2 cut(s) 93, 338
Eco88I CYCGRG 1 cut(s) 118
EcoO109I RGGNCCY 1 cut(s) 93
EcoRII CCWGG 1 cut(s) 340
FaeI CATG 6 cut(s) 48, 127, 396, 407, 416, 536
FatI CATG 6 cut(s) 44, 123, 392, 403, 412, 532
FauI CCCGC 1 cut(s) 120
FauNDI CATATG 1 cut(s) 547
FokI GGATG 4 cut(s) 250, 288, 333, 449
FspBI CTAG 1 cut(s) 78
FspI TGCGCA 1 cut(s) 8
GlaI GCGC 1 cut(s) 8
GsaI CCCAGC 2 cut(s) 29, 40
HaeIII GGCC 2 cut(s) 176, 302
HapII CCGG 1 cut(s) 285
HhaI GCGC 1 cut(s) 9
Hin1II CATG 6 cut(s) 48, 127, 396, 407, 416, 536
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HinfI GANTC 4 cut(s) 81, 116, 293, 428
HpaII CCGG 1 cut(s) 285
HphI GGTGA 4 cut(s) 25, 169, 208, 433
Hpy188I TCNGA 5 cut(s) 268, 292, 298, 307, 481
Hpy188III TCNNGA 4 cut(s) 189, 218, 413, 445
Hpy99I CGWCG 1 cut(s) 190
HpyAV CCTTC 4 cut(s) 154, 162, 186, 418
HpyCH4III ACNGT 1 cut(s) 454
HpyCH4V TGCA 1 cut(s) 365
HpyF10VI GCNNNNNNNGC 2 cut(s) 15, 73
HpyF3I CTNAG 1 cut(s) 291
Hsp92II CATG 6 cut(s) 48, 127, 396, 407, 416, 536
HspAI GCGC 1 cut(s) 7
LweI GCATC 2 cut(s) 127, 352
MaeI CTAG 1 cut(s) 78
MaeIII GTNAC 1 cut(s) 345
MboII GAAGA 2 cut(s) 99, 233
MhlI GDGCHC 1 cut(s) 452
MluCI AATT 2 cut(s) 103, 231
MlyI GAGTC 2 cut(s) 110, 302
MmeI TCCRAC 2 cut(s) 298, 316
MnlI CCTC 5 cut(s) 106, 187, 262, 292, 313
MseI TTAA 2 cut(s) 101, 143
MspI CCGG 1 cut(s) 285
MspR9I CCNGG 1 cut(s) 342
MvaI CCWGG 1 cut(s) 342
MwoI GCNNNNNNNGC 2 cut(s) 15, 73
NdeI CATATG 1 cut(s) 547
NlaIII CATG 6 cut(s) 48, 127, 396, 407, 416, 536
NlaIV GGNNCC 2 cut(s) 94, 390
NsbI TGCGCA 1 cut(s) 8
NspI RCATGY 2 cut(s) 127, 407
PaeI GCATGC 1 cut(s) 127
PagI TCATGA 1 cut(s) 412
PceI AGGCCT 1 cut(s) 302
PcsI WCGNNNNNNNCGW 1 cut(s) 366
PfeI GAWTC 2 cut(s) 81, 428
PflMI CCANNNNNTGG 1 cut(s) 398
PleI GAGTC 2 cut(s) 110, 301
PpsI GAGTC 2 cut(s) 110, 301
PpuMI RGGWCCY 1 cut(s) 93
Psp5II RGGWCCY 1 cut(s) 93
Psp6I CCWGG 1 cut(s) 340
PspFI CCCAGC 2 cut(s) 25, 36
PspGI CCWGG 1 cut(s) 340
PspN4I GGNNCC 2 cut(s) 94, 390
PspPI GGNCC 2 cut(s) 93, 338
PspPPI RGGWCCY 1 cut(s) 93
SaqAI TTAA 2 cut(s) 101, 143
Sau96I GGNCC 2 cut(s) 93, 338
SchI GAGTC 2 cut(s) 110, 302
ScrFI CCNGG 1 cut(s) 342
SduI GDGCHC 1 cut(s) 452
SetI ASST 4 cut(s) 31, 42, 343, 494
SfaNI GCATC 2 cut(s) 127, 352
SinI GGWCC 2 cut(s) 93, 338
SmlI CTYRAG 1 cut(s) 445
SmoI CTYRAG 1 cut(s) 445
SphI GCATGC 1 cut(s) 127
Sse9I AATT 2 cut(s) 103, 231
SseBI AGGCCT 1 cut(s) 302
SsiI CCGC 1 cut(s) 127
SspMI CTAG 1 cut(s) 78
StuI AGGCCT 1 cut(s) 302
StyD4I CCNGG 1 cut(s) 340
TaaI ACNGT 1 cut(s) 454
TaqI TCGA 2 cut(s) 188, 327
TasI AATT 2 cut(s) 103, 231
TfiI GAWTC 2 cut(s) 81, 428
Tru1I TTAA 2 cut(s) 101, 143
Tru9I TTAA 2 cut(s) 101, 143
TspDTI ATGAA 4 cut(s) 33, 401, 516, 521
TspGWI ACGGA 1 cut(s) 241
Van91I CCANNNNNTGG 1 cut(s) 398
VpaK11BI GGWCC 2 cut(s) 93, 338
XapI RAATTY 1 cut(s) 103
XceI RCATGY 2 cut(s) 127, 407
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.