pycom15g37500

Ribosome biogenesis protein SLX9

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
37450713 .. 37451471
759 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g37500.3

Sequence Viewer

Length: 534 bp
ATGCAGTTATTAGCTCTACATGAAATCGGGGTTGCATTAGGAAGGAAAAATGCAGGACCAGGAAAAATTTATCACTACAGTGAAGTTCTTGAAATTCTGGATTTTTTTTTCTTCAAATACTTCCCCAGCCCGGACAAAATGCTATATCAAGCCTTCCACTTGACATTCTGTCCACTCTTCTACCAGAAGAAGAAACTACGTAGCCGACAGAAGAAATTGAAAGCGTATGATCTCTCTTCTTTCTCAGAATTCCTTCCTGAGCTGAAAGAGAAGCGATCCACTGCTGCTTCGGAGTTCAAGATAAATTGTAAATCCAAGAAAAAGCTAGTATTGAAGGAAGGAAAGCAGTTGACTACAGTTCTTAATCATCCCACTTTCAAGTCGAATCCCTTGGCTGCCATTCATCAACACTTACAGAGTACTCAGCCAGTCGAAGATGTCAAACCAGAGAAAAGGAAAAACAAAAGTGGAAGCAAGAAGAGGAAAGAAAAGAAATCTAAGGCATCAGCCGGACCCCAAGCTATGGATATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

178

Amino Acids

20.38

Weight (kDa)

9.96

Isoelectric Point (pI)

51.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 523
AclWI GGATC 1 cut(s) 270
AcsI RAATTY 3 cut(s) 66, 93, 248
AfaI GTAC 1 cut(s) 421
AfiI CCNNNNNNNGG 2 cut(s) 130, 523
AgsI TTSAA 6 cut(s) 92, 115, 220, 298, 334, 379
AhdI GACNNNNNGTC 1 cut(s) 168
AjnI CCWGG 1 cut(s) 58
AleI CACNNNNGTG 1 cut(s) 78
AluBI AGCT 4 cut(s) 14, 262, 325, 521
AluI AGCT 4 cut(s) 14, 262, 325, 521
AlwI GGATC 1 cut(s) 270
ApeKI GCWGC 2 cut(s) 284, 395
ApoI RAATTY 3 cut(s) 66, 93, 248
Asp700I GAANNNNTTC 1 cut(s) 252
AspS9I GGNCC 2 cut(s) 56, 512
AsuC2I CCSGG 1 cut(s) 131
AvaII GGWCC 2 cut(s) 56, 512
BbvI GCAGC 2 cut(s) 271, 382
BciT130I CCWGG 1 cut(s) 60
BcnI CCSGG 1 cut(s) 131
BfaI CTAG 1 cut(s) 326
BfmI CTRYAG 2 cut(s) 76, 354
BisI GCNGC 2 cut(s) 285, 396
BlsI GCNGC 2 cut(s) 286, 397
BmcAI AGTACT 1 cut(s) 421
Bme1390I CCNGG 2 cut(s) 60, 131
Bme18I GGWCC 2 cut(s) 56, 512
BmeRI GACNNNNNGTC 1 cut(s) 168
BmgT120I GGNCC 2 cut(s) 56, 512
BmiI GGNNCC 1 cut(s) 514
BmrFI CCNGG 2 cut(s) 60, 131
BmsI GCATC 1 cut(s) 512
Bpu10I CCTNAGC 1 cut(s) 258
BpuMI CCSGG 1 cut(s) 131
BsaAI YACGTR 1 cut(s) 200
BsaJI CCNNGG 1 cut(s) 390
Bsc4I CCNNNNNNNGG 2 cut(s) 130, 523
Bse1I ACTGG 1 cut(s) 428
BseBI CCWGG 1 cut(s) 60
BseDI CCNNGG 1 cut(s) 390
BseGI GGATG 1 cut(s) 367
BseLI CCNNNNNNNGG 2 cut(s) 130, 523
BseMII CTCAG 3 cut(s) 249, 258, 437
BseNI ACTGG 1 cut(s) 428
BseXI GCAGC 2 cut(s) 271, 382
BseYI CCCAGC 1 cut(s) 125
BsiSI CCGG 2 cut(s) 131, 510
BslI CCNNNNNNNGG 2 cut(s) 130, 523
Bsp143I GATC 2 cut(s) 229, 275
BspCNI CTCAG 3 cut(s) 250, 257, 436
BspLI GGNNCC 1 cut(s) 514
BspPI GGATC 1 cut(s) 270
BsrI ACTGG 1 cut(s) 428
BssECI CCNNGG 1 cut(s) 390
BssMI GATC 2 cut(s) 229, 275
BssT1I CCWWGG 1 cut(s) 390
Bst2UI CCWGG 1 cut(s) 60
Bst4CI ACNGT 2 cut(s) 80, 358
Bst6I CTCTTC 3 cut(s) 182, 241, 473
BstBAI YACGTR 1 cut(s) 200
BstDEI CTNAG 4 cut(s) 244, 258, 423, 498
BstF5I GGATG 1 cut(s) 367
BstKTI GATC 2 cut(s) 232, 278
BstMBI GATC 2 cut(s) 229, 275
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 2 cut(s) 58, 129
BstSFI CTRYAG 2 cut(s) 76, 354
BstSNI TACGTA 1 cut(s) 200
BstV1I GCAGC 2 cut(s) 271, 382
BtsCI GGATG 1 cut(s) 367
BtsI GCAGTG 1 cut(s) 279
BtsIMutI CAGTG 2 cut(s) 85, 279
Cfr13I GGNCC 2 cut(s) 56, 512
Csp6I GTAC 1 cut(s) 420
CviAII CATG 1 cut(s) 20
CviQI GTAC 1 cut(s) 420
DdeI CTNAG 4 cut(s) 244, 258, 423, 498
DpnI GATC 2 cut(s) 231, 277
DpnII GATC 2 cut(s) 229, 275
DriI GACNNNNNGTC 1 cut(s) 168
Eam1104I CTCTTC 3 cut(s) 182, 241, 473
Eam1105I GACNNNNNGTC 1 cut(s) 168
EarI CTCTTC 3 cut(s) 182, 241, 473
Eco105I TACGTA 1 cut(s) 200
Eco130I CCWWGG 1 cut(s) 390
Eco47I GGWCC 2 cut(s) 56, 512
EcoRI GAATTC 1 cut(s) 248
EcoRII CCWGG 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 390
ErhI CCWWGG 1 cut(s) 390
FaeI CATG 1 cut(s) 23
FaiI YATR 5 cut(s) 21, 145, 228, 524, 530
FatI CATG 1 cut(s) 19
Fnu4HI GCNGC 2 cut(s) 285, 396
FokI GGATG 1 cut(s) 354
Fsp4HI GCNGC 2 cut(s) 285, 396
FspBI CTAG 1 cut(s) 326
GluI GCNGC 2 cut(s) 285, 396
GsaI CCCAGC 1 cut(s) 129
HapII CCGG 2 cut(s) 131, 510
Hin1II CATG 1 cut(s) 23
HincII GTYRAC 1 cut(s) 351
HindII GTYRAC 1 cut(s) 351
HinfI GANTC 1 cut(s) 385
HpaII CCGG 2 cut(s) 131, 510
Hpy166II GTNNAC 2 cut(s) 173, 351
Hpy188I TCNGA 2 cut(s) 247, 292
Hpy188III TCNNGA 4 cut(s) 89, 98, 257, 298
Hpy8I GTNNAC 2 cut(s) 173, 351
HpyAV CCTTC 5 cut(s) 36, 163, 263, 328, 332
HpyCH4III ACNGT 2 cut(s) 80, 358
HpyCH4IV ACGT 1 cut(s) 199
HpyCH4V TGCA 3 cut(s) 4, 35, 53
HpyF3I CTNAG 4 cut(s) 244, 258, 423, 498
HpySE526I ACGT 1 cut(s) 199
Hsp92II CATG 1 cut(s) 23
Kzo9I GATC 2 cut(s) 229, 275
Lsp1109I GCAGC 2 cut(s) 271, 382
LweI GCATC 1 cut(s) 512
MaeI CTAG 1 cut(s) 326
MaeII ACGT 1 cut(s) 199
MalI GATC 2 cut(s) 231, 277
MboI GATC 2 cut(s) 229, 275
MboII GAAGA 8 cut(s) 103, 169, 199, 202, 223, 228, 446, 490
MluCI AATT 5 cut(s) 66, 93, 215, 248, 304
MnlI CCTC 1 cut(s) 474
MroXI GAANNNNTTC 1 cut(s) 252
MseI TTAA 1 cut(s) 363
MslI CAYNNNNRTG 1 cut(s) 78
MspI CCGG 2 cut(s) 131, 510
MspR9I CCNGG 2 cut(s) 60, 131
MvaI CCWGG 1 cut(s) 60
NciI CCSGG 1 cut(s) 131
NdeII GATC 2 cut(s) 229, 275
NlaIII CATG 1 cut(s) 23
NlaIV GGNNCC 1 cut(s) 514
OliI CACNNNNGTG 1 cut(s) 78
PdmI GAANNNNTTC 1 cut(s) 252
PfeI GAWTC 1 cut(s) 385
PflMI CCANNNNNTGG 1 cut(s) 523
PkrI GCNGC 2 cut(s) 286, 397
Ppu21I YACGTR 1 cut(s) 200
Psp6I CCWGG 1 cut(s) 58
PspFI CCCAGC 1 cut(s) 125
PspGI CCWGG 1 cut(s) 58
PspN4I GGNNCC 1 cut(s) 514
PspPI GGNCC 2 cut(s) 56, 512
RsaI GTAC 1 cut(s) 421
RsaNI GTAC 1 cut(s) 420
RseI CAYNNNNRTG 1 cut(s) 78
SaqAI TTAA 1 cut(s) 363
SatI GCNGC 2 cut(s) 285, 396
Sau3AI GATC 2 cut(s) 229, 275
Sau96I GGNCC 2 cut(s) 56, 512
ScaI AGTACT 1 cut(s) 421
ScrFI CCNGG 2 cut(s) 60, 131
SetI ASST 5 cut(s) 16, 202, 264, 327, 523
SfaNI GCATC 1 cut(s) 512
SfcI CTRYAG 2 cut(s) 76, 354
SinI GGWCC 2 cut(s) 56, 512
SmiMI CAYNNNNRTG 1 cut(s) 78
SnaBI TACGTA 1 cut(s) 200
Sse9I AATT 5 cut(s) 66, 93, 215, 248, 304
SspMI CTAG 1 cut(s) 326
StyD4I CCNGG 2 cut(s) 58, 129
StyI CCWWGG 1 cut(s) 390
TaaI ACNGT 2 cut(s) 80, 358
TaiI ACGT 1 cut(s) 202
TaqI TCGA 2 cut(s) 383, 432
TasI AATT 5 cut(s) 66, 93, 215, 248, 304
TatI WGTACW 1 cut(s) 419
TfiI GAWTC 1 cut(s) 385
Tru1I TTAA 1 cut(s) 363
Tru9I TTAA 1 cut(s) 363
TscAI CASTG 2 cut(s) 85, 286
TseI GCWGC 2 cut(s) 284, 395
TspDTI ATGAA 2 cut(s) 36, 392
TspRI CASTG 2 cut(s) 85, 286
Van91I CCANNNNNTGG 1 cut(s) 523
VpaK11BI GGWCC 2 cut(s) 56, 512
XapI RAATTY 3 cut(s) 66, 93, 248
XmnI GAANNNNTTC 1 cut(s) 252
XspI CTAG 1 cut(s) 326
ZrmI AGTACT 1 cut(s) 421
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.