Rh6AG077900

Ribosome biogenesis protein SLX9

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0006226
Physical Location & Seq
Reverse (-)
11272566 .. 11275085
2520 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG077900.1

Sequence Viewer

Length: 330 bp
ATGCATAATACAGATGTTAGAGATAGAGTTGCGGCCTTGAGTACCCAGAAGGCTATTGTCAAGAAGAAGAAAGTATGTAGCCAGAAGAAGAAACTGAAAGCATATGATCTCTCTTCCTTTTCTGAATTCCTGCCTGAGTTTGAGGATTCACAAGAACCAGCTCCTACCATTGATTTCAAGCTAATATTGAAGGAAGCAGAGCAGTTGGGTAGAGTTCTTAATCACCCTGCTTTCCAGGCAGATCCGATGGCAGCTATTTGTGAACACTTGAAGAACACACAACCTGTGATGGCTGAGCAACGGAAGAAACGGGAAAAAAAATGGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SLX9

Protein Analysis

109

Amino Acids

12.58

Weight (kDa)

9.52

Isoelectric Point (pI)

42.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SLX9 PF15341 60 - 93 2.3e-06 Ribosome biogenesis protein SLX9
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 236
AcsI RAATTY 1 cut(s) 125
AfaI GTAC 1 cut(s) 43
AgsI TTSAA 3 cut(s) 178, 190, 271
AjnI CCWGG 1 cut(s) 234
AluBI AGCT 3 cut(s) 161, 181, 254
AluI AGCT 3 cut(s) 161, 181, 254
AlwI GGATC 1 cut(s) 236
AoxI GGCC 1 cut(s) 33
ApeKI GCWGC 1 cut(s) 251
ApoI RAATTY 1 cut(s) 125
AsuHPI GGTGA 1 cut(s) 215
BbvI GCAGC 1 cut(s) 263
BccI CCATC 2 cut(s) 241, 283
BciT130I CCWGG 1 cut(s) 236
BisI GCNGC 2 cut(s) 33, 252
BlpI GCTNAGC 1 cut(s) 294
BlsI GCNGC 2 cut(s) 34, 253
Bme1390I CCNGG 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 236
Bpu1102I GCTNAGC 1 cut(s) 294
BpuEI CTTGAG 1 cut(s) 58
BseBI CCWGG 1 cut(s) 236
BseMII CTCAG 2 cut(s) 126, 285
BseXI GCAGC 1 cut(s) 263
BshFI GGCC 1 cut(s) 35
BsnI GGCC 1 cut(s) 35
Bsp143I GATC 2 cut(s) 106, 241
Bsp1720I GCTNAGC 1 cut(s) 294
BspACI CCGC 1 cut(s) 32
BspANI GGCC 1 cut(s) 35
BspCNI CTCAG 2 cut(s) 127, 286
BspPI GGATC 1 cut(s) 236
BssMI GATC 2 cut(s) 106, 241
Bst2UI CCWGG 1 cut(s) 236
Bst6I CTCTTC 1 cut(s) 118
BstDEI CTNAG 2 cut(s) 135, 294
BstKTI GATC 2 cut(s) 109, 244
BstMBI GATC 2 cut(s) 106, 241
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstNI CCWGG 1 cut(s) 236
BstSCI CCNGG 1 cut(s) 234
BstV1I GCAGC 1 cut(s) 263
BstX2I RGATCY 1 cut(s) 241
BstYI RGATCY 1 cut(s) 241
BsuRI GGCC 1 cut(s) 35
Csp6I GTAC 1 cut(s) 42
CviJI RGCY 7 cut(s) 35, 53, 81, 161, 181, 254, 293
CviKI_1 RGCY 7 cut(s) 35, 53, 81, 161, 181, 254, 293
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 2 cut(s) 135, 294
DpnI GATC 2 cut(s) 108, 243
DpnII GATC 2 cut(s) 106, 241
Eam1104I CTCTTC 1 cut(s) 118
EarI CTCTTC 1 cut(s) 118
EcoRI GAATTC 1 cut(s) 125
EcoRII CCWGG 1 cut(s) 234
EcoT22I ATGCAT 1 cut(s) 6
FaiI YATR 4 cut(s) 6, 76, 103, 105
FauNDI CATATG 1 cut(s) 103
Fnu4HI GCNGC 2 cut(s) 33, 252
Fsp4HI GCNGC 2 cut(s) 33, 252
GluI GCNGC 2 cut(s) 33, 252
HaeIII GGCC 1 cut(s) 35
HinfI GANTC 1 cut(s) 146
HphI GGTGA 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 263
Hpy188I TCNGA 2 cut(s) 124, 246
Hpy188III TCNNGA 1 cut(s) 61
Hpy8I GTNNAC 1 cut(s) 263
HpyAV CCTTC 2 cut(s) 43, 184
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
HpyF3I CTNAG 2 cut(s) 135, 294
Kzo9I GATC 2 cut(s) 106, 241
LmnI GCTCC 1 cut(s) 166
LpnPI CCDG 9 cut(s) 59, 95, 143, 147, 171, 221, 240, 248, 297
Lsp1109I GCAGC 1 cut(s) 263
MalI GATC 2 cut(s) 108, 243
MboI GATC 2 cut(s) 106, 241
MboII GAAGA 7 cut(s) 76, 79, 97, 100, 105, 283, 316
MflI RGATCY 1 cut(s) 241
MluCI AATT 1 cut(s) 125
MnlI CCTC 1 cut(s) 136
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 219
MspR9I CCNGG 1 cut(s) 236
MvaI CCWGG 1 cut(s) 236
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeI CATATG 1 cut(s) 103
NdeII GATC 2 cut(s) 106, 241
NsiI ATGCAT 1 cut(s) 6
PfeI GAWTC 1 cut(s) 146
PkrI GCNGC 2 cut(s) 34, 253
Psp6I CCWGG 1 cut(s) 234
PspGI CCWGG 1 cut(s) 234
PsuI RGATCY 1 cut(s) 241
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 2 cut(s) 33, 252
Sau3AI GATC 2 cut(s) 106, 241
ScrFI CCNGG 1 cut(s) 236
SetI ASST 4 cut(s) 163, 183, 256, 286
SmlI CTYRAG 1 cut(s) 37
SmoI CTYRAG 1 cut(s) 37
Sse9I AATT 1 cut(s) 125
SsiI CCGC 1 cut(s) 32
SspI AATATT 1 cut(s) 186
StyD4I CCNGG 1 cut(s) 234
TasI AATT 1 cut(s) 125
TauI GCSGC 1 cut(s) 35
TfiI GAWTC 1 cut(s) 146
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TseI GCWGC 1 cut(s) 251
TspGWI ACGGA 1 cut(s) 316
XapI RAATTY 1 cut(s) 125
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.