Rh7BG341700

Ribosome biogenesis protein SLX9

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0006226
Physical Location & Seq
Forward (+)
35631571 .. 35636081
4511 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG341700.1

Sequence Viewer

Length: 279 bp
ATGGGCAAGCCTGGTTCACGTCAAGACTTGTCGACCAAAGCCGACCGCAAATTCGAAAAGAAGCTCGATTTCTATGCTAAGGTTAGAGATACAGTTTCTACCTTGAGTACCCAGAAAACTATTGTTAAGAAGAAGAAACTCCGTAGCCGGCAGAAGAAACTGAAAGCATATGATCTCTCTGCCCTAACAGAGTTCCTGCCGGAGTTGAAGGGTGAACAGAAGCCAACTCCTCCATCAGACTTAAAGCGAAATTGTAAATCTATGCGAAAGCTAATGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SLX9

Protein Analysis

92

Amino Acids

10.65

Weight (kDa)

10.29

Isoelectric Point (pI)

34.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 32
AciI CCGC 1 cut(s) 46
AcsI RAATTY 1 cut(s) 50
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 1 cut(s) 208
AjiI CACGTC 1 cut(s) 20
AjnI CCWGG 1 cut(s) 10
AluBI AGCT 2 cut(s) 64, 271
AluI AGCT 2 cut(s) 64, 271
ApoI RAATTY 1 cut(s) 50
ArsI GACNNNNNNTTYG 2 cut(s) 35, 67
AsuHPI GGTGA 1 cut(s) 224
AsuII TTCGAA 1 cut(s) 54
BccI CCATC 1 cut(s) 241
BcgI CGANNNNNNTGC 2 cut(s) 56, 90
BciT130I CCWGG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 12
BmgBI CACGTC 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 12
Bpu10I CCTNAGC 1 cut(s) 78
Bpu14I TTCGAA 1 cut(s) 54
BpuEI CTTGAG 1 cut(s) 124
Bse118I RCCGGY 1 cut(s) 147
BseBI CCWGG 1 cut(s) 12
BseRI GAGGAG 1 cut(s) 219
Bsh1285I CGRYCG 1 cut(s) 46
BsiEI CGRYCG 1 cut(s) 46
BsiSI CCGG 2 cut(s) 148, 200
Bsp119I TTCGAA 1 cut(s) 54
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 46
BspT104I TTCGAA 1 cut(s) 54
BsrFI RCCGGY 1 cut(s) 147
BssAI RCCGGY 1 cut(s) 147
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 12
Bst4CI ACNGT 1 cut(s) 94
BstBI TTCGAA 1 cut(s) 54
BstC8I GCNNGC 2 cut(s) 8, 149
BstDEI CTNAG 1 cut(s) 78
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstMCI CGRYCG 1 cut(s) 46
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BtrI CACGTC 1 cut(s) 20
Cac8I GCNNGC 2 cut(s) 8, 149
Cfr10I RCCGGY 1 cut(s) 147
Csp6I GTAC 1 cut(s) 108
CviJI RGCY 6 cut(s) 10, 41, 64, 147, 223, 271
CviKI_1 RGCY 6 cut(s) 10, 41, 64, 147, 223, 271
CviQI GTAC 1 cut(s) 108
DdeI CTNAG 1 cut(s) 78
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
EcoRII CCWGG 1 cut(s) 10
FaiI YATR 4 cut(s) 75, 169, 171, 263
FauNDI CATATG 1 cut(s) 169
FblI GTMKAC 1 cut(s) 32
HapII CCGG 2 cut(s) 148, 200
HincII GTYRAC 1 cut(s) 33
HindII GTYRAC 1 cut(s) 33
HpaII CCGG 2 cut(s) 148, 200
HphI GGTGA 1 cut(s) 224
Hpy166II GTNNAC 3 cut(s) 17, 33, 215
Hpy188I TCNGA 1 cut(s) 238
Hpy188III TCNNGA 1 cut(s) 23
Hpy8I GTNNAC 3 cut(s) 17, 33, 215
HpyAV CCTTC 1 cut(s) 202
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 78
HpySE526I ACGT 1 cut(s) 19
KroI GCCGGC 1 cut(s) 147
KroNI GCCGGC 1 cut(s) 149
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 5 cut(s) 24, 125, 161, 209, 213
MaeII ACGT 1 cut(s) 19
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 3 cut(s) 142, 145, 166
MluCI AATT 2 cut(s) 50, 250
MnlI CCTC 1 cut(s) 240
MroNI GCCGGC 1 cut(s) 147
MseI TTAA 2 cut(s) 126, 242
MspI CCGG 2 cut(s) 148, 200
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
NaeI GCCGGC 1 cut(s) 149
NdeI CATATG 1 cut(s) 169
NdeII GATC 1 cut(s) 172
NgoMIV GCCGGC 1 cut(s) 147
NspV TTCGAA 1 cut(s) 54
PdiI GCCGGC 1 cut(s) 149
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
SalI GTCGAC 1 cut(s) 31
SaqAI TTAA 2 cut(s) 126, 242
Sau3AI GATC 1 cut(s) 172
ScrFI CCNGG 1 cut(s) 12
SetI ASST 5 cut(s) 22, 66, 84, 104, 273
SfuI TTCGAA 1 cut(s) 54
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 2 cut(s) 50, 250
SsiI CCGC 1 cut(s) 46
StyD4I CCNGG 1 cut(s) 10
TaaI ACNGT 1 cut(s) 94
TaiI ACGT 1 cut(s) 22
TaqI TCGA 3 cut(s) 32, 54, 66
TasI AATT 2 cut(s) 50, 250
Tru1I TTAA 2 cut(s) 126, 242
Tru9I TTAA 2 cut(s) 126, 242
TspGWI ACGGA 1 cut(s) 131
XapI RAATTY 1 cut(s) 50
XmiI GTMKAC 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.