pycom16g12090

receptor-like protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Forward (+)
8451683 .. 8451940
258 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g12090.1

Sequence Viewer

Length: 258 bp
ATGATTCTTGCGGTGCTATCAATTTGTCTTACTTCGCGAAAGAGATCAAGAAAGTCTAATGACGTGCTTCCTCTGGGCCGAATTCCAAATGATTCAAAGGAAATCAAAGAGATCAGGGTTGATCAAGCTTCTGCAAATAACTATATACCCCGTAATATTTCTTCTCTCACCCTTGGTGATAAATTCAGTGACAGAGAGTCAGAGAAAGTGTTGATCCATAAGAATGGAGATAGTAGCAGATCGATCAGGCTCATTTAA

Protein Analysis

86

Amino Acids

9.58

Weight (kDa)

10.0

Isoelectric Point (pI)

57.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 37
AciI CCGC 1 cut(s) 11
AclWI GGATC 1 cut(s) 208
AcsI RAATTY 2 cut(s) 81, 182
AgsI TTSAA 1 cut(s) 96
AhdI GACNNNNNGTC 1 cut(s) 196
AjiI CACGTC 1 cut(s) 64
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
AlwI GGATC 1 cut(s) 208
AoxI GGCC 1 cut(s) 76
ApoI RAATTY 2 cut(s) 81, 182
AspS9I GGNCC 1 cut(s) 76
AsuHPI GGTGA 2 cut(s) 160, 188
BarI GAAGNNNNNNTAC 2 cut(s) 145, 177
BclI TGATCA 1 cut(s) 121
BmeRI GACNNNNNGTC 1 cut(s) 196
BmgBI CACGTC 1 cut(s) 64
BmgT120I GGNCC 1 cut(s) 76
Bsa29I ATCGAT 1 cut(s) 242
BsaJI CCNNGG 1 cut(s) 172
BseCI ATCGAT 1 cut(s) 242
BseDI CCNNGG 1 cut(s) 172
Bsh1236I CGCG 1 cut(s) 37
BshFI GGCC 1 cut(s) 78
BshVI ATCGAT 1 cut(s) 242
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 6 cut(s) 44, 111, 121, 213, 239, 243
Bsp68I TCGCGA 1 cut(s) 37
BspACI CCGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 78
BspDI ATCGAT 1 cut(s) 242
BspFNI CGCG 1 cut(s) 37
BspPI GGATC 1 cut(s) 208
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 6 cut(s) 44, 111, 121, 213, 239, 243
BssT1I CCWWGG 1 cut(s) 172
BstFNI CGCG 1 cut(s) 37
BstKTI GATC 6 cut(s) 47, 114, 124, 216, 242, 246
BstMBI GATC 6 cut(s) 44, 111, 121, 213, 239, 243
BstUI CGCG 1 cut(s) 37
BstXI CCANNNNNNTGG 1 cut(s) 224
Bsu15I ATCGAT 1 cut(s) 242
BsuRI GGCC 1 cut(s) 78
BsuTUI ATCGAT 1 cut(s) 242
BtrI CACGTC 1 cut(s) 64
BtsIMutI CAGTG 1 cut(s) 193
BtuMI TCGCGA 1 cut(s) 37
Cfr13I GGNCC 1 cut(s) 76
ClaI ATCGAT 1 cut(s) 242
CviJI RGCY 3 cut(s) 78, 128, 250
CviKI_1 RGCY 3 cut(s) 78, 128, 250
DpnI GATC 6 cut(s) 46, 113, 123, 215, 241, 245
DpnII GATC 6 cut(s) 44, 111, 121, 213, 239, 243
DriI GACNNNNNGTC 1 cut(s) 196
Eam1105I GACNNNNNGTC 1 cut(s) 196
Eco130I CCWWGG 1 cut(s) 172
EcoRI GAATTC 1 cut(s) 81
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaiI YATR 3 cut(s) 144, 146, 219
FbaI TGATCA 1 cut(s) 121
HaeIII GGCC 1 cut(s) 78
HindIII AAGCTT 1 cut(s) 126
HinfI GANTC 3 cut(s) 4, 92, 197
HphI GGTGA 2 cut(s) 160, 188
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 2 cut(s) 36, 48
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 1 cut(s) 134
HpySE526I ACGT 1 cut(s) 63
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 6 cut(s) 44, 111, 121, 213, 239, 243
LpnPI CCDG 3 cut(s) 59, 100, 232
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 188
MalI GATC 6 cut(s) 46, 113, 123, 215, 241, 245
MboI GATC 6 cut(s) 44, 111, 121, 213, 239, 243
MboII GAAGA 1 cut(s) 153
MluCI AATT 3 cut(s) 21, 81, 182
MlyI GAGTC 1 cut(s) 206
MnlI CCTC 1 cut(s) 81
MseI TTAA 1 cut(s) 256
MslI CAYNNNNRTG 1 cut(s) 222
MvnI CGCG 1 cut(s) 37
NdeII GATC 6 cut(s) 44, 111, 121, 213, 239, 243
NmuCI GTSAC 1 cut(s) 188
NruI TCGCGA 1 cut(s) 37
PfeI GAWTC 2 cut(s) 4, 92
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PspPI GGNCC 1 cut(s) 76
RruI TCGCGA 1 cut(s) 37
RseI CAYNNNNRTG 1 cut(s) 222
SaqAI TTAA 1 cut(s) 256
Sau3AI GATC 6 cut(s) 44, 111, 121, 213, 239, 243
Sau96I GGNCC 1 cut(s) 76
SchI GAGTC 1 cut(s) 206
SetI ASST 2 cut(s) 66, 130
SgeI CNNG 9 cut(s) 20, 48, 60, 76, 86, 127, 137, 162, 185
SmiMI CAYNNNNRTG 1 cut(s) 222
Sse9I AATT 3 cut(s) 21, 81, 182
SsiI CCGC 1 cut(s) 11
SspI AATATT 1 cut(s) 157
StyI CCWWGG 1 cut(s) 172
TaiI ACGT 1 cut(s) 66
TaqI TCGA 1 cut(s) 242
TasI AATT 3 cut(s) 21, 81, 182
TfiI GAWTC 2 cut(s) 4, 92
Tru1I TTAA 1 cut(s) 256
Tru9I TTAA 1 cut(s) 256
TscAI CASTG 1 cut(s) 193
TseFI GTSAC 1 cut(s) 188
Tsp45I GTSAC 1 cut(s) 188
TspRI CASTG 1 cut(s) 193
XapI RAATTY 2 cut(s) 81, 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.