pycom16g21430

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0013640
Physical Location & Seq
Reverse (-)
19888288 .. 19888662
375 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g21430.1

Sequence Viewer

Length: 375 bp
ATGCCTGAATTATTTACCCTTAAAATTAACCACGATGGGAAGTGGTCTGAAAATGCATATACGAGAGGGTTTGAGGCTTGGTTTGATTACGTAGACAAAGACTTCATGTCTTTTTTCGAGATTGATGAAATGATTAAGGAGTTAGGATATGACGGGTTTATCTTGTATCACTATAAGATTCTAGGGATGTCTTATAGGGAGGGATTAAGGCTTATTGAACGGGACCAAGATGTGGGTAAAATGTGCAAGTATGTTCCAGGGACTAGGGAAATAGAAATGTACCTAGAACATCTAAGTCTGAAACAAGCTGCCATGAAACATAAGCTTTTAATGAATCTAGATGAGAGTGGCATATTAAAAAAGGTGTCACTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DBD_Tnp_Mut MULE SWIM

Protein Analysis

125

Amino Acids

14.75

Weight (kDa)

5.56

Isoelectric Point (pI)

44.94

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PB1-like PF26130 1 - 97 3.2e-17 PB1-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 232
AccI GTMKAC 1 cut(s) 93
AfaI GTAC 1 cut(s) 281
AfiI CCNNNNNNNGG 1 cut(s) 232
AgsI TTSAA 1 cut(s) 218
AhdI GACNNNNNGTC 1 cut(s) 106
AjnI CCWGG 1 cut(s) 256
AluBI AGCT 2 cut(s) 308, 325
AluI AGCT 2 cut(s) 308, 325
ApeKI GCWGC 1 cut(s) 308
AspS9I GGNCC 1 cut(s) 223
AvaII GGWCC 1 cut(s) 223
BbvI GCAGC 1 cut(s) 295
BccI CCATC 1 cut(s) 29
BciT130I CCWGG 1 cut(s) 258
BfaI CTAG 4 cut(s) 182, 264, 284, 338
BisI GCNGC 1 cut(s) 309
BlsI GCNGC 1 cut(s) 310
Bme1390I CCNGG 1 cut(s) 258
Bme18I GGWCC 1 cut(s) 223
BmeRI GACNNNNNGTC 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 1 cut(s) 224
BmrFI CCNGG 1 cut(s) 258
BsaAI YACGTR 1 cut(s) 91
BsaJI CCNNGG 1 cut(s) 257
Bsc4I CCNNNNNNNGG 1 cut(s) 232
BseBI CCWGG 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 257
BseGI GGATG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 232
BseXI GCAGC 1 cut(s) 295
BslFI GGGAC 2 cut(s) 236, 274
BslI CCNNNNNNNGG 1 cut(s) 232
BsmFI GGGAC 2 cut(s) 236, 274
BspLI GGNNCC 1 cut(s) 224
BssECI CCNNGG 1 cut(s) 257
Bst2UI CCWGG 1 cut(s) 258
BstBAI YACGTR 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 293
BstF5I GGATG 1 cut(s) 192
BstNI CCWGG 1 cut(s) 258
BstSCI CCNGG 1 cut(s) 256
BstSNI TACGTA 1 cut(s) 91
BstV1I GCAGC 1 cut(s) 295
BtsCI GGATG 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 223
Csp6I GTAC 1 cut(s) 280
CviAII CATG 2 cut(s) 106, 313
CviJI RGCY 4 cut(s) 77, 211, 308, 325
CviKI_1 RGCY 4 cut(s) 77, 211, 308, 325
CviQI GTAC 1 cut(s) 280
DdeI CTNAG 1 cut(s) 293
DriI GACNNNNNGTC 1 cut(s) 106
Eam1105I GACNNNNNGTC 1 cut(s) 106
Eco105I TACGTA 1 cut(s) 91
Eco47I GGWCC 1 cut(s) 223
EcoRII CCWGG 1 cut(s) 256
EcoT22I ATGCAT 1 cut(s) 58
FaeI CATG 2 cut(s) 109, 316
FaqI GGGAC 2 cut(s) 236, 274
FatI CATG 2 cut(s) 105, 312
FblI GTMKAC 1 cut(s) 93
Fnu4HI GCNGC 1 cut(s) 309
FokI GGATG 1 cut(s) 199
Fsp4HI GCNGC 1 cut(s) 309
FspBI CTAG 4 cut(s) 182, 264, 284, 338
GluI GCNGC 1 cut(s) 309
Hin1II CATG 2 cut(s) 109, 316
HindIII AAGCTT 1 cut(s) 323
HinfI GANTC 2 cut(s) 178, 334
Hpy166II GTNNAC 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 49, 300
Hpy188III TCNNGA 2 cut(s) 118, 338
Hpy8I GTNNAC 1 cut(s) 94
HpyCH4IV ACGT 1 cut(s) 90
HpyCH4V TGCA 2 cut(s) 56, 246
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 1 cut(s) 90
Hsp92II CATG 2 cut(s) 109, 316
LpnPI CCDG 3 cut(s) 18, 243, 270
Lsp1109I GCAGC 1 cut(s) 295
MaeI CTAG 4 cut(s) 182, 264, 284, 338
MaeII ACGT 1 cut(s) 90
MaeIII GTNAC 1 cut(s) 366
MluCI AATT 2 cut(s) 8, 24
MnlI CCTC 3 cut(s) 59, 67, 193
Mph1103I ATGCAT 1 cut(s) 58
MseI TTAA 6 cut(s) 21, 27, 135, 206, 329, 356
MspR9I CCNGG 1 cut(s) 258
MvaI CCWGG 1 cut(s) 258
NlaIII CATG 2 cut(s) 109, 316
NlaIV GGNNCC 1 cut(s) 224
NmuCI GTSAC 1 cut(s) 366
NsiI ATGCAT 1 cut(s) 58
PfeI GAWTC 2 cut(s) 178, 334
PflMI CCANNNNNTGG 1 cut(s) 232
PkrI GCNGC 1 cut(s) 310
Ppu21I YACGTR 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
PspN4I GGNNCC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 223
RsaI GTAC 1 cut(s) 281
RsaNI GTAC 1 cut(s) 280
SaqAI TTAA 6 cut(s) 21, 27, 135, 206, 329, 356
SatI GCNGC 1 cut(s) 309
Sau96I GGNCC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 258
SetI ASST 5 cut(s) 93, 285, 310, 327, 366
SinI GGWCC 1 cut(s) 223
SnaBI TACGTA 1 cut(s) 91
Sse9I AATT 2 cut(s) 8, 24
SspMI CTAG 4 cut(s) 182, 264, 284, 338
StyD4I CCNGG 1 cut(s) 256
TaiI ACGT 1 cut(s) 93
TaqI TCGA 1 cut(s) 117
TasI AATT 2 cut(s) 8, 24
TfiI GAWTC 2 cut(s) 178, 334
Tru1I TTAA 6 cut(s) 21, 27, 135, 206, 329, 356
Tru9I TTAA 6 cut(s) 21, 27, 135, 206, 329, 356
TseFI GTSAC 1 cut(s) 366
TseI GCWGC 1 cut(s) 308
Tsp45I GTSAC 1 cut(s) 366
TspDTI ATGAA 4 cut(s) 94, 141, 329, 347
Van91I CCANNNNNTGG 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 223
XbaI TCTAGA 1 cut(s) 337
XmiI GTMKAC 1 cut(s) 93
XspI CTAG 4 cut(s) 182, 264, 284, 338
Zsp2I ATGCAT 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.