pycom17g09730

RIBOSOMAL protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0005111
Physical Location & Seq
Forward (+)
7414431 .. 7414859
429 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 345 bp
ATGTGTAGGTTGGAGAAGAAAATGAATGCTTTCAAGGCTTATAAAGCCAGTGTCCCAATTGCATGGAGCCCTAATCTGTATATAACTTTGGTGAGGGGAATCCCCGGAACTAGGAGACTTCACAGGCGTACTTTAGAGGCATTACGTCTCGGAAAGTGCAATCGAACTGTCATGCGATGGAATACTCCTACAGTTAGGGGAATGCTCCAACAGGTTAAGAGATTGGTCGTGATTGAGACAGAAGAGATGTATAAGGCCCGCAAGCAAAACTTGGAAAGTCACCGAGCTCTACGTCCCCCATTGGTCGTAAATCACCATCCTGGTTCTGCAAGTGGACCTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03010 map03010
Pfam Domains
Protein Families
Ribosomal_L30

Protein Analysis

115

Amino Acids

13.11

Weight (kDa)

11.34

Isoelectric Point (pI)

56.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L30 PF00327 27 - 76 5e-17 Ribosomal protein L30p/L7e
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 42
AciI CCGC 1 cut(s) 259
AfaI GTAC 1 cut(s) 130
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 34
AjnI CCWGG 1 cut(s) 319
AluBI AGCT 1 cut(s) 287
AluI AGCT 1 cut(s) 287
Alw21I GWGCWC 1 cut(s) 289
Alw26I GTCTC 3 cut(s) 109, 152, 230
AoxI GGCC 1 cut(s) 255
Asp700I GAANNNNTTC 1 cut(s) 29
AspS9I GGNCC 2 cut(s) 256, 335
AsuC2I CCSGG 1 cut(s) 105
AsuHPI GGTGA 3 cut(s) 103, 272, 305
AvaII GGWCC 1 cut(s) 335
BanII GRGCYC 2 cut(s) 71, 289
Bbv12I GWGCWC 1 cut(s) 289
BccI CCATC 2 cut(s) 171, 324
BciT130I CCWGG 1 cut(s) 321
BcnI CCSGG 1 cut(s) 105
BcoDI GTCTC 3 cut(s) 109, 152, 230
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 189
Bme1390I CCNGG 2 cut(s) 105, 321
Bme18I GGWCC 1 cut(s) 335
BmgT120I GGNCC 2 cut(s) 256, 335
BmiI GGNNCC 1 cut(s) 68
BmrFI CCNGG 2 cut(s) 105, 321
BpuMI CCSGG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 103
Bsc4I CCNNNNNNNGG 1 cut(s) 111
Bse1I ACTGG 1 cut(s) 48
BseBI CCWGG 1 cut(s) 321
BseDI CCNNGG 1 cut(s) 103
BseGI GGATG 1 cut(s) 316
BseLI CCNNNNNNNGG 1 cut(s) 111
BseNI ACTGG 1 cut(s) 48
BshFI GGCC 1 cut(s) 257
BsiHKAI GWGCWC 1 cut(s) 289
BsiSI CCGG 1 cut(s) 105
BslFI GGGAC 2 cut(s) 38, 279
BslI CCNNNNNNNGG 1 cut(s) 111
BsmAI GTCTC 3 cut(s) 109, 152, 230
BsmBI CGTCTC 1 cut(s) 152
BsmFI GGGAC 2 cut(s) 38, 279
BsmI GAATGC 2 cut(s) 31, 207
BsnI GGCC 1 cut(s) 257
Bsp1286I GDGCHC 2 cut(s) 71, 289
BspACI CCGC 1 cut(s) 259
BspANI GGCC 1 cut(s) 257
BspLI GGNNCC 1 cut(s) 68
BsrI ACTGG 1 cut(s) 48
BssECI CCNNGG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 321
Bst4CI ACNGT 2 cut(s) 169, 193
Bst6I CTCTTC 1 cut(s) 237
BstC8I GCNNGC 2 cut(s) 259, 263
BstF5I GGATG 1 cut(s) 316
BstMAI GTCTC 3 cut(s) 109, 152, 230
BstMWI GCNNNNNNNGC 2 cut(s) 35, 44
BstNI CCWGG 1 cut(s) 321
BstSCI CCNGG 2 cut(s) 103, 319
BstSFI CTRYAG 1 cut(s) 189
BstXI CCANNNNNNTGG 1 cut(s) 63
BsuRI GGCC 1 cut(s) 257
BtgZI GCGATG 1 cut(s) 190
BtsCI GGATG 1 cut(s) 316
BtsIMutI CAGTG 1 cut(s) 55
Cac8I GCNNGC 2 cut(s) 259, 263
Cfr13I GGNCC 2 cut(s) 256, 335
Csp6I GTAC 1 cut(s) 129
CviAII CATG 2 cut(s) 63, 172
CviJI RGCY 5 cut(s) 38, 47, 69, 257, 287
CviKI_1 RGCY 5 cut(s) 38, 47, 69, 257, 287
CviQI GTAC 1 cut(s) 129
Eam1104I CTCTTC 1 cut(s) 237
EarI CTCTTC 1 cut(s) 237
Ecl136II GAGCTC 1 cut(s) 287
Eco24I GRGCYC 2 cut(s) 71, 289
Eco47I GGWCC 1 cut(s) 335
Eco53kI GAGCTC 1 cut(s) 287
EcoICRI GAGCTC 1 cut(s) 287
EcoRII CCWGG 1 cut(s) 319
EcoT38I GRGCYC 2 cut(s) 71, 289
Esp3I CGTCTC 1 cut(s) 152
FaeI CATG 2 cut(s) 66, 175
FaiI YATR 6 cut(s) 42, 64, 81, 83, 173, 252
FalI AAGNNNNNCTT 3 cut(s) 254, 286, 322
FaqI GGGAC 2 cut(s) 38, 279
FatI CATG 2 cut(s) 62, 171
FauI CCCGC 1 cut(s) 266
FokI GGATG 1 cut(s) 303
FriOI GRGCYC 2 cut(s) 71, 289
FspBI CTAG 1 cut(s) 111
HaeIII GGCC 1 cut(s) 257
HapII CCGG 1 cut(s) 105
Hin1II CATG 2 cut(s) 66, 175
HinfI GANTC 1 cut(s) 99
HpaII CCGG 1 cut(s) 105
HphI GGTGA 3 cut(s) 103, 272, 305
Hpy166II GTNNAC 1 cut(s) 335
Hpy188I TCNGA 1 cut(s) 152
Hpy188III TCNNGA 1 cut(s) 229
Hpy8I GTNNAC 1 cut(s) 335
HpyCH4III ACNGT 2 cut(s) 169, 193
HpyCH4IV ACGT 2 cut(s) 145, 292
HpyCH4V TGCA 3 cut(s) 62, 159, 329
HpyF10VI GCNNNNNNNGC 2 cut(s) 35, 44
HpySE526I ACGT 2 cut(s) 145, 292
Hsp92II CATG 2 cut(s) 66, 175
LmnI GCTCC 2 cut(s) 66, 210
LpnPI CCDG 6 cut(s) 61, 109, 118, 197, 306, 333
MaeI CTAG 1 cut(s) 111
MaeII ACGT 2 cut(s) 145, 292
MaeIII GTNAC 1 cut(s) 278
MboII GAAGA 2 cut(s) 28, 254
MfeI CAATTG 1 cut(s) 57
MhlI GDGCHC 2 cut(s) 71, 289
MluCI AATT 1 cut(s) 57
MmeI TCCRAC 1 cut(s) 232
MnlI CCTC 2 cut(s) 87, 130
MroXI GAANNNNTTC 1 cut(s) 29
MseI TTAA 2 cut(s) 216, 343
MspI CCGG 1 cut(s) 105
MspR9I CCNGG 2 cut(s) 105, 321
MunI CAATTG 1 cut(s) 57
Mva1269I GAATGC 2 cut(s) 31, 207
MvaI CCWGG 1 cut(s) 321
MwoI GCNNNNNNNGC 2 cut(s) 35, 44
NciI CCSGG 1 cut(s) 105
NlaIII CATG 2 cut(s) 66, 175
NlaIV GGNNCC 1 cut(s) 68
NmuCI GTSAC 1 cut(s) 278
PctI GAATGC 2 cut(s) 31, 207
PdmI GAANNNNTTC 1 cut(s) 29
PfeI GAWTC 1 cut(s) 99
PsiI TTATAA 1 cut(s) 42
Psp124BI GAGCTC 1 cut(s) 289
Psp6I CCWGG 1 cut(s) 319
PspGI CCWGG 1 cut(s) 319
PspN4I GGNNCC 1 cut(s) 68
PspPI GGNCC 2 cut(s) 256, 335
RsaI GTAC 1 cut(s) 130
RsaNI GTAC 1 cut(s) 129
SacI GAGCTC 1 cut(s) 289
SaqAI TTAA 2 cut(s) 216, 343
Sau96I GGNCC 2 cut(s) 256, 335
ScrFI CCNGG 2 cut(s) 105, 321
SduI GDGCHC 2 cut(s) 71, 289
SetI ASST 6 cut(s) 11, 148, 216, 289, 295, 340
SfcI CTRYAG 1 cut(s) 189
SinI GGWCC 1 cut(s) 335
Sse9I AATT 1 cut(s) 57
SsiI CCGC 1 cut(s) 259
SspMI CTAG 1 cut(s) 111
SstI GAGCTC 1 cut(s) 289
StyD4I CCNGG 2 cut(s) 103, 319
TaaI ACNGT 2 cut(s) 169, 193
TaiI ACGT 2 cut(s) 148, 295
TaqI TCGA 1 cut(s) 163
TasI AATT 1 cut(s) 57
TfiI GAWTC 1 cut(s) 99
Tru1I TTAA 2 cut(s) 216, 343
Tru9I TTAA 2 cut(s) 216, 343
TscAI CASTG 1 cut(s) 55
TseFI GTSAC 1 cut(s) 278
Tsp45I GTSAC 1 cut(s) 278
TspDTI ATGAA 1 cut(s) 38
TspRI CASTG 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 335
XmnI GAANNNNTTC 1 cut(s) 29
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.