pycom17g22270

Catalyzes the oxidation of 3-carboxy-2-hydroxy-4- methylpentanoate (3-isopropylmalate) to 3-carboxy-4-methyl-2- oxopentanoate. The product decarboxylates to 4-methyl-2 oxopentanoate

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0006646
Physical Location & Seq
Forward (+)
20715232 .. 20716326
1095 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 333 bp
ATGATCACTGGAAGTATTGGGATGCTGCCATCTGCTAGTCTTGGGGAATCGGGTCCTGGACTTTATGAACCCATACATGGTTCTGCTCCTGATATTGCTGGACAGGATAAAGCAAACCCATTAGCGACAGTTCTCAGTGCTGCTATGCTTTTGAAGTACGGTTCAGGTGAAGAAAAGGCTGCCAAGAGAATTGAGGATGCAGTTCTAGATACTTTGAATGGGGGGTTTCGGACTGGTGACATATATTCCACTGGAACTAAATTGGTAGGATGCAAAGAAATGGGTGAAGAGGTATTGAAGTCTGTTGATTCCCAAGTTCCGTCTCCAGTATGA

Protein Analysis

111

Amino Acids

11.27

Weight (kDa)

4.7

Isoelectric Point (pI)

32.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Iso_dh PF00180 1 - 98 1.6e-37 Isocitrate/isopropylmalate dehydrogenase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 77
AgsI TTSAA 3 cut(s) 154, 217, 298
AjnI CCWGG 1 cut(s) 55
Alw26I GTCTC 1 cut(s) 327
ApeKI GCWGC 3 cut(s) 25, 140, 179
AspS9I GGNCC 1 cut(s) 53
AsuHPI GGTGA 3 cut(s) 179, 248, 296
AvaII GGWCC 1 cut(s) 53
BbvI GCAGC 3 cut(s) 12, 127, 166
BccI CCATC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 57
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 327
BfaI CTAG 2 cut(s) 36, 206
BisI GCNGC 3 cut(s) 26, 141, 180
BlsI GCNGC 3 cut(s) 27, 142, 181
Bme1390I CCNGG 1 cut(s) 57
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 1 cut(s) 53
BmiI GGNNCC 1 cut(s) 54
BmrFI CCNGG 1 cut(s) 57
BmsI GCATC 3 cut(s) 12, 187, 260
BpmI CTGGAG 1 cut(s) 309
Bsc4I CCNNNNNNNGG 1 cut(s) 77
Bse1I ACTGG 4 cut(s) 13, 238, 256, 326
BseBI CCWGG 1 cut(s) 57
BseGI GGATG 3 cut(s) 27, 202, 275
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMII CTCAG 1 cut(s) 148
BseNI ACTGG 4 cut(s) 13, 238, 256, 326
BseXI GCAGC 3 cut(s) 12, 127, 166
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 327
BsmBI CGTCTC 1 cut(s) 327
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 1 cut(s) 54
BsrI ACTGG 4 cut(s) 13, 238, 256, 326
BssMI GATC 1 cut(s) 3
Bst2UI CCWGG 1 cut(s) 57
Bst4CI ACNGT 2 cut(s) 130, 161
Bst6I CTCTTC 1 cut(s) 282
BstDEI CTNAG 1 cut(s) 134
BstF5I GGATG 3 cut(s) 27, 202, 275
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 327
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 1 cut(s) 57
BstSCI CCNGG 1 cut(s) 55
BstV1I GCAGC 3 cut(s) 12, 127, 166
BtsCI GGATG 3 cut(s) 27, 202, 275
BtsIMutI CAGTG 3 cut(s) 6, 142, 249
Cfr13I GGNCC 1 cut(s) 53
Csp6I GTAC 1 cut(s) 157
CviAII CATG 1 cut(s) 77
CviJI RGCY 1 cut(s) 179
CviKI_1 RGCY 1 cut(s) 179
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 282
EarI CTCTTC 1 cut(s) 282
Eco47I GGWCC 1 cut(s) 53
EcoO109I RGGNCCY 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 55
Esp3I CGTCTC 1 cut(s) 327
FaeI CATG 1 cut(s) 80
FaiI YATR 7 cut(s) 66, 74, 78, 146, 242, 244, 331
FatI CATG 1 cut(s) 76
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 3 cut(s) 26, 141, 180
FokI GGATG 3 cut(s) 34, 209, 282
Fsp4HI GCNGC 3 cut(s) 26, 141, 180
FspBI CTAG 2 cut(s) 36, 206
GluI GCNGC 3 cut(s) 26, 141, 180
GsuI CTGGAG 1 cut(s) 309
Hin1II CATG 1 cut(s) 80
HinfI GANTC 2 cut(s) 47, 308
HphI GGTGA 3 cut(s) 179, 248, 296
Hpy188I TCNGA 1 cut(s) 231
Hpy188III TCNNGA 2 cut(s) 89, 206
HpyCH4III ACNGT 2 cut(s) 130, 161
HpyCH4V TGCA 2 cut(s) 200, 273
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 1 cut(s) 80
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 8 cut(s) 42, 69, 84, 89, 102, 150, 219, 237
Lsp1109I GCAGC 3 cut(s) 12, 127, 166
LweI GCATC 3 cut(s) 12, 187, 260
MaeI CTAG 2 cut(s) 36, 206
MaeIII GTNAC 1 cut(s) 236
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 2 cut(s) 182, 299
MluCI AATT 2 cut(s) 189, 260
MnlI CCTC 2 cut(s) 187, 283
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 80
NlaIV GGNNCC 1 cut(s) 54
NmuCI GTSAC 1 cut(s) 236
PfeI GAWTC 2 cut(s) 47, 308
PfoI TCCNGGA 1 cut(s) 55
PkrI GCNGC 3 cut(s) 27, 142, 181
PpuMI RGGWCCY 1 cut(s) 53
Psp5II RGGWCCY 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
PspN4I GGNNCC 1 cut(s) 54
PspPI GGNCC 1 cut(s) 53
PspPPI RGGWCCY 1 cut(s) 53
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
SatI GCNGC 3 cut(s) 26, 141, 180
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 53
ScrFI CCNGG 1 cut(s) 57
SetI ASST 2 cut(s) 169, 294
SfaNI GCATC 3 cut(s) 12, 187, 260
SinI GGWCC 1 cut(s) 53
Sse9I AATT 2 cut(s) 189, 260
SspMI CTAG 2 cut(s) 36, 206
StyD4I CCNGG 1 cut(s) 55
TaaI ACNGT 2 cut(s) 130, 161
TasI AATT 2 cut(s) 189, 260
TfiI GAWTC 2 cut(s) 47, 308
TscAI CASTG 3 cut(s) 13, 142, 256
TseFI GTSAC 1 cut(s) 236
TseI GCWGC 3 cut(s) 25, 140, 179
Tsp45I GTSAC 1 cut(s) 236
TspDTI ATGAA 1 cut(s) 81
TspGWI ACGGA 1 cut(s) 309
TspRI CASTG 3 cut(s) 13, 142, 256
VpaK11BI GGWCC 1 cut(s) 53
XbaI TCTAGA 1 cut(s) 205
XspI CTAG 2 cut(s) 36, 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.