Rmu_sc0001782.1_g000053

Catalyzes the oxidation of 3-carboxy-2-hydroxy-4- methylpentanoate (3-isopropylmalate) to 3-carboxy-4-methyl-2- oxopentanoate. The product decarboxylates to 4-methyl-2 oxopentanoate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001782.1
Physical Location & Seq
Forward (+)
249261 .. 254025
4765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001782.1_g000053.1.cds

Sequence Viewer

Length: 474 bp
atgattaccggaagtattgggatgcttccatctgctagtcttggagaatcaggtcttggactttttgaacctatacatggttctggtcttgatattgctggacaggataaggcaaacccattagcaacggttctcagtgctgctatgcttttgaagtacggtcttggagaagaaaatgctgccaagagaattgaggcagcagtccttgatactttgaaccggggccttcaaatcccagaaaccaccgctgcccaccttgaagatctcaactctaggagtccagaaccggcggacccgcccccagaaccggccggaaaatatccgaaccggccaccggaaatatctatatcctccctgcccggttcgaagccttcctccctgcctactgctaccaaacttcaccggaagctgcaaccagaccccagatcaccggagccgaaaaatctccaccggaaccggcctaaattcaactga

Protein Analysis

157

Amino Acids

16.62

Weight (kDa)

6.92

Isoelectric Point (pI)

59.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 246, 290, 296
AcoI YGGCCR 2 cut(s) 309, 329
AcsI RAATTY 1 cut(s) 464
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 3 cut(s) 77, 307, 334
AgsI TTSAA 6 cut(s) 68, 154, 217, 230, 260, 469
AjuI GAANNNNNNNTTGG 2 cut(s) 39, 71
AluBI AGCT 1 cut(s) 409
AluI AGCT 1 cut(s) 409
AoxI GGCC 4 cut(s) 223, 309, 329, 458
ApeKI GCWGC 5 cut(s) 140, 179, 197, 248, 409
ApoI RAATTY 1 cut(s) 464
AspS9I GGNCC 2 cut(s) 223, 292
AsuC2I CCSGG 2 cut(s) 221, 360
AsuHPI GGTGA 2 cut(s) 392, 420
AsuII TTCGAA 1 cut(s) 365
AvaII GGWCC 1 cut(s) 292
BbvI GCAGC 5 cut(s) 127, 166, 209, 235, 396
BccI CCATC 1 cut(s) 37
BcnI CCSGG 2 cut(s) 221, 360
BfaI CTAG 2 cut(s) 36, 273
BglII AGATCT 1 cut(s) 262
BisI GCNGC 5 cut(s) 141, 180, 198, 249, 410
BlsI GCNGC 5 cut(s) 142, 181, 199, 250, 411
Bme1390I CCNGG 2 cut(s) 221, 360
Bme18I GGWCC 1 cut(s) 292
BmgT120I GGNCC 2 cut(s) 223, 292
BmiI GGNNCC 4 cut(s) 224, 294, 435, 455
BmrFI CCNGG 2 cut(s) 221, 360
BmsI GCATC 1 cut(s) 12
Bpu14I TTCGAA 1 cut(s) 365
BpuMI CCSGG 2 cut(s) 221, 360
BsaJI CCNNGG 1 cut(s) 220
BsaWI WCCGGW 5 cut(s) 8, 334, 402, 430, 450
Bsc4I CCNNNNNNNGG 3 cut(s) 77, 307, 334
Bse118I RCCGGY 4 cut(s) 286, 307, 327, 456
BseDI CCNNGG 1 cut(s) 220
BseGI GGATG 1 cut(s) 27
BseLI CCNNNNNNNGG 3 cut(s) 77, 307, 334
BseMII CTCAG 1 cut(s) 148
BseX3I CGGCCG 1 cut(s) 309
BseXI GCAGC 5 cut(s) 127, 166, 209, 235, 396
Bsh1285I CGRYCG 1 cut(s) 312
BshFI GGCC 4 cut(s) 225, 311, 331, 460
BsiEI CGRYCG 1 cut(s) 312
BslI CCNNNNNNNGG 3 cut(s) 77, 307, 334
BsnI GGCC 4 cut(s) 225, 311, 331, 460
Bsp119I TTCGAA 1 cut(s) 365
Bsp143I GATC 2 cut(s) 262, 425
BspACI CCGC 3 cut(s) 246, 290, 296
BspANI GGCC 4 cut(s) 225, 311, 331, 460
BspCNI CTCAG 1 cut(s) 147
BspLI GGNNCC 4 cut(s) 224, 294, 435, 455
BspT104I TTCGAA 1 cut(s) 365
BsrFI RCCGGY 4 cut(s) 286, 307, 327, 456
BssAI RCCGGY 4 cut(s) 286, 307, 327, 456
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 2 cut(s) 262, 425
Bst4CI ACNGT 2 cut(s) 130, 161
BstBI TTCGAA 1 cut(s) 365
BstDEI CTNAG 1 cut(s) 134
BstF5I GGATG 1 cut(s) 27
BstKTI GATC 2 cut(s) 265, 428
BstMBI GATC 2 cut(s) 262, 425
BstMCI CGRYCG 1 cut(s) 312
BstSCI CCNGG 2 cut(s) 219, 358
BstV1I GCAGC 5 cut(s) 127, 166, 209, 235, 396
BstX2I RGATCY 1 cut(s) 262
BstYI RGATCY 1 cut(s) 262
BstZI CGGCCG 1 cut(s) 309
BsuRI GGCC 4 cut(s) 225, 311, 331, 460
BtsCI GGATG 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 142
Cfr10I RCCGGY 4 cut(s) 286, 307, 327, 456
Cfr13I GGNCC 2 cut(s) 223, 292
Csp6I GTAC 1 cut(s) 157
CviAII CATG 1 cut(s) 77
CviJI RGCY 7 cut(s) 225, 311, 331, 370, 409, 436, 460
CviKI_1 RGCY 7 cut(s) 225, 311, 331, 370, 409, 436, 460
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 1 cut(s) 134
DpnI GATC 2 cut(s) 264, 427
DpnII GATC 2 cut(s) 262, 425
EaeI YGGCCR 2 cut(s) 309, 329
EagI CGGCCG 1 cut(s) 309
EciI GGCGGA 1 cut(s) 305
EclXI CGGCCG 1 cut(s) 309
Eco47I GGWCC 1 cut(s) 292
Eco52I CGGCCG 1 cut(s) 309
EcoO109I RGGNCCY 1 cut(s) 223
FaeI CATG 1 cut(s) 80
FaiI YATR 4 cut(s) 74, 78, 146, 347
FatI CATG 1 cut(s) 76
FauI CCCGC 1 cut(s) 303
Fnu4HI GCNGC 5 cut(s) 141, 180, 198, 249, 410
FokI GGATG 1 cut(s) 34
Fsp4HI GCNGC 5 cut(s) 141, 180, 198, 249, 410
FspBI CTAG 2 cut(s) 36, 273
GluI GCNGC 5 cut(s) 141, 180, 198, 249, 410
HaeIII GGCC 4 cut(s) 225, 311, 331, 460
Hin1II CATG 1 cut(s) 80
HinfI GANTC 2 cut(s) 47, 277
HphI GGTGA 2 cut(s) 392, 420
Hpy188I TCNGA 1 cut(s) 324
Hpy188III TCNNGA 2 cut(s) 89, 281
HpyAV CCTTC 2 cut(s) 236, 381
HpyCH4III ACNGT 2 cut(s) 130, 161
HpyCH4V TGCA 1 cut(s) 412
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 1 cut(s) 80
Kzo9I GATC 2 cut(s) 262, 425
LmnI GCTCC 1 cut(s) 433
Lsp1109I GCAGC 5 cut(s) 127, 166, 209, 235, 396
LweI GCATC 1 cut(s) 12
MaeI CTAG 2 cut(s) 36, 273
MalI GATC 2 cut(s) 264, 427
MboI GATC 2 cut(s) 262, 425
MboII GAAGA 2 cut(s) 182, 272
MflI RGATCY 1 cut(s) 262
MluCI AATT 2 cut(s) 189, 464
MlyI GAGTC 1 cut(s) 286
MnlI CCTC 3 cut(s) 187, 361, 385
MspA1I CMGCKG 1 cut(s) 248
MspR9I CCNGG 2 cut(s) 221, 360
NciI CCSGG 2 cut(s) 221, 360
NdeII GATC 2 cut(s) 262, 425
NlaIII CATG 1 cut(s) 80
NlaIV GGNNCC 4 cut(s) 224, 294, 435, 455
NspV TTCGAA 1 cut(s) 365
PfeI GAWTC 1 cut(s) 47
PkrI GCNGC 5 cut(s) 142, 181, 199, 250, 411
PleI GAGTC 1 cut(s) 285
PpsI GAGTC 1 cut(s) 285
PspN4I GGNNCC 4 cut(s) 224, 294, 435, 455
PspPI GGNCC 2 cut(s) 223, 292
PsuI RGATCY 1 cut(s) 262
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
SatI GCNGC 5 cut(s) 141, 180, 198, 249, 410
Sau3AI GATC 2 cut(s) 262, 425
Sau96I GGNCC 2 cut(s) 223, 292
SchI GAGTC 1 cut(s) 286
ScrFI CCNGG 2 cut(s) 221, 360
SetI ASST 4 cut(s) 55, 73, 258, 411
SfaNI GCATC 1 cut(s) 12
SfuI TTCGAA 1 cut(s) 365
SinI GGWCC 1 cut(s) 292
Sse9I AATT 2 cut(s) 189, 464
SsiI CCGC 3 cut(s) 246, 290, 296
SspMI CTAG 2 cut(s) 36, 273
StyD4I CCNGG 2 cut(s) 219, 358
TaaI ACNGT 2 cut(s) 130, 161
TaqI TCGA 1 cut(s) 365
TasI AATT 2 cut(s) 189, 464
TfiI GAWTC 1 cut(s) 47
TscAI CASTG 1 cut(s) 142
TseI GCWGC 5 cut(s) 140, 179, 197, 248, 409
TspRI CASTG 1 cut(s) 142
VpaK11BI GGWCC 1 cut(s) 292
XapI RAATTY 1 cut(s) 464
XspI CTAG 2 cut(s) 36, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.