RchiOBHm_Chr5g0004121

NDR1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
2593314 .. 2593966
653 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 582 bp
ATGTGTGAAAGTGAAAAAACGTATTTCCATGCGTGTGTTCTGGAAACTTTGGCAATTCTGGGTCTTCTGGCCTTTTTTCTGTGGCTAATTTTTCACGTGAAATCCCCTAGTTATACCATTGTGGATATCACCATCCCAAAGTCTAGTTTAGAGAATGGGGGTCAGAATGGCTATATTGTCTATGCCCTTGAAATTAAAAACTCCAACACATACTACAGTATTTACTATGATACCTCACTCTTGACGTTCAATTGTGGGCAGGATAAAGTTGGAGAGAAAACCATACCTCCTTTTCATCAAGGAACTGGCAGAAGCAGACGGCGTACGGTGATTGATTATATGGATGCCAATCCACAAGTGTGGAGAGCTGTTCGCAAATCAATATCGAATGCAAGTGCAGAATTGAAGGTGGGTTTACTAACTAGGATTCGATACACAACATGGGGAACCAAGAGGCATCATGTGCTAGACTTGCAAGGTTTGTTACCAATAGGTAAAGACGGCAAGCTTTCTGGTAAGAAGAAGAAAATCAAGCTAAGATATGCTTCCAAGAAACTGAGGACGAATAGTCTTCGATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

193

Amino Acids

22.03

Weight (kDa)

9.84

Isoelectric Point (pI)

33.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LEA_2 PF03168 63 - 154 2.3e-06 Late embryogenesis abundant protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcvI CACGTG 1 cut(s) 97
AfaI GTAC 1 cut(s) 325
AgsI TTSAA 3 cut(s) 191, 250, 406
AhdI GACNNNNNGTC 1 cut(s) 567
AleI CACNNNNGTG 1 cut(s) 358
AluBI AGCT 3 cut(s) 368, 508, 535
AluI AGCT 3 cut(s) 368, 508, 535
AoxI GGCC 1 cut(s) 69
AsuHPI GGTGA 2 cut(s) 121, 340
BbrPI CACGTG 1 cut(s) 97
BbsI GAAGAC 2 cut(s) 56, 563
BccI CCATC 1 cut(s) 140
BceAI ACGGC 2 cut(s) 335, 517
BfaI CTAG 4 cut(s) 108, 144, 423, 467
BfmI CTRYAG 1 cut(s) 214
BmeRI GACNNNNNGTC 1 cut(s) 567
BmiI GGNNCC 1 cut(s) 448
BmsI GCATC 2 cut(s) 334, 466
BpiI GAAGAC 2 cut(s) 56, 563
BsaAI YACGTR 1 cut(s) 97
BsaBI GATNNNNATC 1 cut(s) 348
BsaXI ACNNNNNCTCC 2 cut(s) 271, 301
Bse1I ACTGG 1 cut(s) 310
Bse8I GATNNNNATC 1 cut(s) 348
BseGI GGATG 2 cut(s) 132, 349
BseJI GATNNNNATC 1 cut(s) 348
BseMII CTCAG 1 cut(s) 548
BseNI ACTGG 1 cut(s) 310
BsgI GTGCAG 1 cut(s) 417
BshFI GGCC 1 cut(s) 71
BsiWI CGTACG 1 cut(s) 323
BsmI GAATGC 1 cut(s) 394
BsnI GGCC 1 cut(s) 71
BspANI GGCC 1 cut(s) 71
BspCNI CTCAG 1 cut(s) 549
BspLI GGNNCC 1 cut(s) 448
BsrI ACTGG 1 cut(s) 310
Bst4CI ACNGT 2 cut(s) 218, 328
BstAPI GCANNNNNTGC 1 cut(s) 463
BstBAI YACGTR 1 cut(s) 97
BstC8I GCNNGC 1 cut(s) 506
BstDEI CTNAG 2 cut(s) 536, 557
BstF5I GGATG 2 cut(s) 132, 349
BstMWI GCNNNNNNNGC 2 cut(s) 463, 472
BstSFI CTRYAG 1 cut(s) 214
BstV2I GAAGAC 2 cut(s) 56, 563
BstXI CCANNNNNNTGG 1 cut(s) 360
BsuRI GGCC 1 cut(s) 71
BtsCI GGATG 2 cut(s) 132, 349
Cac8I GCNNGC 1 cut(s) 506
Csp6I GTAC 1 cut(s) 324
CviAII CATG 3 cut(s) 29, 441, 461
CviJI RGCY 6 cut(s) 71, 85, 171, 368, 508, 535
CviKI_1 RGCY 6 cut(s) 71, 85, 171, 368, 508, 535
CviQI GTAC 1 cut(s) 324
DdeI CTNAG 2 cut(s) 536, 557
DriI GACNNNNNGTC 1 cut(s) 567
Eam1105I GACNNNNNGTC 1 cut(s) 567
Eco32I GATATC 1 cut(s) 127
Eco72I CACGTG 1 cut(s) 97
EcoRV GATATC 1 cut(s) 127
FaeI CATG 3 cut(s) 32, 444, 464
FalI AAGNNNNNCTT 2 cut(s) 529, 561
FatI CATG 3 cut(s) 28, 440, 460
FokI GGATG 2 cut(s) 119, 356
FspBI CTAG 4 cut(s) 108, 144, 423, 467
HaeIII GGCC 1 cut(s) 71
Hin1II CATG 3 cut(s) 32, 444, 464
HindIII AAGCTT 1 cut(s) 506
HinfI GANTC 1 cut(s) 427
HphI GGTGA 2 cut(s) 121, 340
Hpy166II GTNNAC 1 cut(s) 416
Hpy188I TCNGA 1 cut(s) 165
Hpy188III TCNNGA 2 cut(s) 41, 241
Hpy8I GTNNAC 1 cut(s) 416
HpyAV CCTTC 1 cut(s) 400
HpyCH4III ACNGT 2 cut(s) 218, 328
HpyCH4IV ACGT 3 cut(s) 20, 96, 245
HpyCH4V TGCA 3 cut(s) 392, 398, 475
HpyF10VI GCNNNNNNNGC 2 cut(s) 463, 472
HpyF3I CTNAG 2 cut(s) 536, 557
HpySE526I ACGT 3 cut(s) 20, 96, 245
Hsp92II CATG 3 cut(s) 32, 444, 464
LpnPI CCDG 6 cut(s) 26, 44, 53, 245, 291, 498
LweI GCATC 2 cut(s) 334, 466
MaeI CTAG 4 cut(s) 108, 144, 423, 467
MaeII ACGT 3 cut(s) 20, 96, 245
MaeIII GTNAC 1 cut(s) 483
MboII GAAGA 4 cut(s) 56, 532, 535, 563
MfeI CAATTG 1 cut(s) 250
MluCI AATT 5 cut(s) 54, 87, 192, 250, 401
MmeI TCCRAC 2 cut(s) 228, 250
MnlI CCTC 4 cut(s) 244, 297, 447, 552
MseI TTAA 1 cut(s) 195
MslI CAYNNNNRTG 2 cut(s) 33, 358
MunI CAATTG 1 cut(s) 250
Mva1269I GAATGC 1 cut(s) 394
MwoI GCNNNNNNNGC 2 cut(s) 463, 472
NlaIII CATG 3 cut(s) 32, 444, 464
NlaIV GGNNCC 1 cut(s) 448
OliI CACNNNNGTG 1 cut(s) 358
PctI GAATGC 1 cut(s) 394
PfeI GAWTC 1 cut(s) 427
Pfl23II CGTACG 1 cut(s) 323
PmaCI CACGTG 1 cut(s) 97
PmlI CACGTG 1 cut(s) 97
Ppu21I YACGTR 1 cut(s) 97
PspCI CACGTG 1 cut(s) 97
PspLI CGTACG 1 cut(s) 323
PspN4I GGNNCC 1 cut(s) 448
RsaI GTAC 1 cut(s) 325
RsaNI GTAC 1 cut(s) 324
RseI CAYNNNNRTG 2 cut(s) 33, 358
SaqAI TTAA 1 cut(s) 195
SfaNI GCATC 2 cut(s) 334, 466
SfcI CTRYAG 1 cut(s) 214
SmiMI CAYNNNNRTG 2 cut(s) 33, 358
Sse9I AATT 5 cut(s) 54, 87, 192, 250, 401
SspMI CTAG 4 cut(s) 108, 144, 423, 467
TaaI ACNGT 2 cut(s) 218, 328
TaiI ACGT 3 cut(s) 23, 99, 248
TaqI TCGA 3 cut(s) 386, 430, 574
TasI AATT 5 cut(s) 54, 87, 192, 250, 401
TfiI GAWTC 1 cut(s) 427
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TspDTI ATGAA 1 cut(s) 284
XspI CTAG 4 cut(s) 108, 144, 423, 467
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.