Rh5BG036600

NDR1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
2564926 .. 2566515
1590 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG036600.1

Sequence Viewer

Length: 288 bp
ATGGCAATTAGAAACTCCATATTGAATGGAACTGCAGAACTGAAGGTGGCTTTACGAACTCAGCTTCAATACAAAACCTTGGGAAGAAACAGCAAGCATCATGGGGTAAACTTGCAAGCTGTATTACCAATCGGGCCAGATGGCAAGATTTCTGGTAAGAAGAAGAAAATCAAGCTAAAGCGCCATTTTGAAGGAATATATGCCCAGTTTGATAAAACCTCGTGTTGCAGAAGCAAAGGCCTAAGTCTAGCACAGATATCCAGTCAGCAAAAGTTGATGATGAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

95

Amino Acids

10.57

Weight (kDa)

10.43

Isoelectric Point (pI)

30.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 62
AgsI TTSAA 3 cut(s) 25, 68, 191
AluBI AGCT 3 cut(s) 64, 119, 175
AluI AGCT 3 cut(s) 64, 119, 175
AoxI GGCC 2 cut(s) 134, 238
AspLEI GCGC 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 134
BauI CACGAG 1 cut(s) 220
BccI CCATC 1 cut(s) 134
BfaI CTAG 1 cut(s) 248
BfmI CTRYAG 1 cut(s) 33
BfoI RGCGCY 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 134
BmrI ACTGGG 1 cut(s) 199
BmsI GCATC 1 cut(s) 106
BmuI ACTGGG 1 cut(s) 199
BsaJI CCNNGG 1 cut(s) 78
Bse1I ACTGG 2 cut(s) 205, 261
BseDI CCNNGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 74
BseNI ACTGG 2 cut(s) 205, 261
BshFI GGCC 2 cut(s) 136, 240
BsnI GGCC 2 cut(s) 136, 240
BspANI GGCC 2 cut(s) 136, 240
BspCNI CTCAG 1 cut(s) 73
BspMAI CTGCAG 1 cut(s) 37
BsrI ACTGG 2 cut(s) 205, 261
BssECI CCNNGG 1 cut(s) 78
BssSI CACGAG 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 78
Bst2BI CACGAG 1 cut(s) 220
BstC8I GCNNGC 2 cut(s) 95, 117
BstDEI CTNAG 2 cut(s) 60, 242
BstH2I RGCGCY 1 cut(s) 184
BstHHI GCGC 1 cut(s) 183
BstSFI CTRYAG 1 cut(s) 33
BsuRI GGCC 2 cut(s) 136, 240
Cac8I GCNNGC 2 cut(s) 95, 117
CfoI GCGC 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 1 cut(s) 101
CviJI RGCY 6 cut(s) 50, 64, 119, 136, 175, 240
CviKI_1 RGCY 6 cut(s) 50, 64, 119, 136, 175, 240
DdeI CTNAG 2 cut(s) 60, 242
Eco130I CCWWGG 1 cut(s) 78
Eco147I AGGCCT 1 cut(s) 240
Eco32I GATATC 1 cut(s) 258
Eco57I CTGAAG 1 cut(s) 62
EcoRV GATATC 1 cut(s) 258
EcoT14I CCWWGG 1 cut(s) 78
ErhI CCWWGG 1 cut(s) 78
FaeI CATG 1 cut(s) 104
FaiI YATR 4 cut(s) 20, 102, 199, 201
FatI CATG 1 cut(s) 100
FspBI CTAG 1 cut(s) 248
GlaI GCGC 1 cut(s) 182
HaeII RGCGCY 1 cut(s) 184
HaeIII GGCC 2 cut(s) 136, 240
HhaI GCGC 1 cut(s) 183
Hin1II CATG 1 cut(s) 104
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 2 cut(s) 37, 185
HpyCH4V TGCA 3 cut(s) 35, 115, 228
HpyF3I CTNAG 2 cut(s) 60, 242
Hsp92II CATG 1 cut(s) 104
HspAI GCGC 1 cut(s) 181
LpnPI CCDG 4 cut(s) 138, 150, 218, 274
LweI GCATC 1 cut(s) 106
MaeI CTAG 1 cut(s) 248
MboII GAAGA 3 cut(s) 96, 172, 175
MluCI AATT 1 cut(s) 6
MnlI CCTC 1 cut(s) 229
NlaIII CATG 1 cut(s) 104
PceI AGGCCT 1 cut(s) 240
PspPI GGNCC 1 cut(s) 134
PstI CTGCAG 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 134
SetI ASST 6 cut(s) 48, 66, 80, 121, 177, 221
SfaNI GCATC 1 cut(s) 106
SfcI CTRYAG 1 cut(s) 33
Sse9I AATT 1 cut(s) 6
SseBI AGGCCT 1 cut(s) 240
SspMI CTAG 1 cut(s) 248
StuI AGGCCT 1 cut(s) 240
StyI CCWWGG 1 cut(s) 78
TasI AATT 1 cut(s) 6
XspI CTAG 1 cut(s) 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.