Rmu_sc0000547.1_g000032

NDR1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000547.1
OG0006390
Physical Location & Seq
Forward (+)
145825 .. 148166
2342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000547.1_g000032.1.cds

Sequence Viewer

Length: 969 bp
atgtgcgaaagcgaaaacaagcatttctatttgtgtgtcttagaaattttggcccttttgggtcttctggccttagttctttggctaagtttacgcccaaagtccccttgttataccattgtggatatcaccattccaaattctgatatagagaatggggcacagaatggctctattgtgtatgttcttgagattgaaaactctaacaaagactccagtgttttttatgatacctcagtcttgacgttctattatgggcaggataaagttgcagagaaaaccatacctccttttcatcaaggaagaagcaaaacccgtacggtgatggatgatattgatgccaatccacaggtgtggagatctgttcgcaattcaatatcgaatgcaactgcagagttgaaggtgactttgctaactaagattagatacaaaacatggggaatcaagagtaagcgtcacgggcaagacttgcaaggtgcattaccaataggtaaagacggcaagctttctgatatcaccatcccaaagtctagtttagagaatgggggtcagaatggctatattgtctatgcccttgaaattaaaaactccaacacatactacagtatttactatgatacctcactcttgacgttcaattatgggcaggataaagttggagagaaaaccatacctccttttcatcaaggaactggcagaagcagacggcgtacggtgattgattatatggatgccaatccacaagtgtggagagctgttagcaaatcaatatcgaatgcaagtgcagaattgaaggtgggtttactaactaggattcgatacacaacatggggaaccaagaggcatcatgtgctagacttgcaaggtttgttaccaataggtaaagacggcaagctttctggtaagaagaagaaaatcaagctaagatatgcttccaagaaactgaggacgaatagtcgtcgatattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

322

Amino Acids

36.4

Weight (kDa)

9.69

Isoelectric Point (pI)

37.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 45, 139
AfaI GTAC 2 cut(s) 319, 712
AgsI TTSAA 6 cut(s) 197, 375, 400, 578, 637, 793
AhdI GACNNNNNGTC 1 cut(s) 954
AleI CACNNNNGTG 2 cut(s) 352, 745
AluBI AGCT 4 cut(s) 505, 755, 895, 922
AluI AGCT 4 cut(s) 505, 755, 895, 922
AoxI GGCC 2 cut(s) 51, 69
ApoI RAATTY 2 cut(s) 45, 139
AspS9I GGNCC 1 cut(s) 52
AsuHPI GGTGA 5 cut(s) 121, 334, 415, 508, 727
BaeGI GKGCMC 1 cut(s) 163
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BbsI GAAGAC 1 cut(s) 56
BccI CCATC 2 cut(s) 319, 527
BceAI ACGGC 3 cut(s) 514, 722, 904
BfaI CTAG 3 cut(s) 531, 810, 854
BfmI CTRYAG 2 cut(s) 390, 601
BglII AGATCT 1 cut(s) 359
BmeRI GACNNNNNGTC 1 cut(s) 954
BmgT120I GGNCC 1 cut(s) 52
BmiI GGNNCC 1 cut(s) 835
BmsI GCATC 3 cut(s) 328, 721, 853
BpiI GAAGAC 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 199
BpuEI CTTGAG 1 cut(s) 209
BsaBI GATNNNNATC 2 cut(s) 342, 735
BsaXI ACNNNNNCTCC 6 cut(s) 197, 227, 271, 301, 658, 688
Bse1I ACTGG 2 cut(s) 216, 697
Bse8I GATNNNNATC 2 cut(s) 342, 735
BseGI GGATG 3 cut(s) 334, 519, 736
BseJI GATNNNNATC 2 cut(s) 342, 735
BseMII CTCAG 2 cut(s) 249, 935
BseNI ACTGG 2 cut(s) 216, 697
BseSI GKGCMC 1 cut(s) 163
BsgI GTGCAG 1 cut(s) 804
BshFI GGCC 2 cut(s) 53, 71
BsiWI CGTACG 2 cut(s) 317, 710
BslFI GGGAC 1 cut(s) 88
BsmFI GGGAC 1 cut(s) 88
BsmI GAATGC 2 cut(s) 388, 781
BsnI GGCC 2 cut(s) 53, 71
Bsp1286I GDGCHC 1 cut(s) 163
Bsp143I GATC 1 cut(s) 359
BspANI GGCC 2 cut(s) 53, 71
BspCNI CTCAG 2 cut(s) 248, 936
BspLI GGNNCC 1 cut(s) 835
BspMAI CTGCAG 1 cut(s) 394
BsrI ACTGG 2 cut(s) 216, 697
BssMI GATC 1 cut(s) 359
Bst4CI ACNGT 3 cut(s) 322, 605, 715
BstAPI GCANNNNNTGC 2 cut(s) 469, 850
BstC8I GCNNGC 2 cut(s) 503, 893
BstDEI CTNAG 7 cut(s) 40, 73, 86, 235, 417, 923, 944
BstF5I GGATG 3 cut(s) 334, 519, 736
BstKTI GATC 1 cut(s) 362
BstMBI GATC 1 cut(s) 359
BstMWI GCNNNNNNNGC 4 cut(s) 460, 469, 850, 859
BstSFI CTRYAG 2 cut(s) 390, 601
BstSLI GKGCMC 1 cut(s) 163
BstV2I GAAGAC 1 cut(s) 56
BstX2I RGATCY 1 cut(s) 359
BstXI CCANNNNNNTGG 2 cut(s) 354, 747
BstYI RGATCY 1 cut(s) 359
BsuRI GGCC 2 cut(s) 53, 71
BtsCI GGATG 3 cut(s) 334, 519, 736
BtsIMutI CAGTG 1 cut(s) 223
Cac8I GCNNGC 2 cut(s) 503, 893
Cfr13I GGNCC 1 cut(s) 52
CseI GACGC 1 cut(s) 443
Csp6I GTAC 2 cut(s) 318, 711
CviAII CATG 3 cut(s) 435, 828, 848
CviJI RGCY 9 cut(s) 53, 71, 85, 171, 505, 558, 755, 895, 922
CviKI_1 RGCY 9 cut(s) 53, 71, 85, 171, 505, 558, 755, 895, 922
CviQI GTAC 2 cut(s) 318, 711
DdeI CTNAG 7 cut(s) 40, 73, 86, 235, 417, 923, 944
DpnI GATC 1 cut(s) 361
DpnII GATC 1 cut(s) 359
DriI GACNNNNNGTC 1 cut(s) 954
Eam1105I GACNNNNNGTC 1 cut(s) 954
Eco32I GATATC 2 cut(s) 127, 514
EcoRV GATATC 2 cut(s) 127, 514
FaeI CATG 3 cut(s) 438, 831, 851
FalI AAGNNNNNCTT 2 cut(s) 916, 948
FaqI GGGAC 1 cut(s) 88
FatI CATG 3 cut(s) 434, 827, 847
FokI GGATG 3 cut(s) 341, 506, 743
FspBI CTAG 3 cut(s) 531, 810, 854
GsuI CTGGAG 1 cut(s) 199
HaeIII GGCC 2 cut(s) 53, 71
HgaI GACGC 1 cut(s) 443
Hin1II CATG 3 cut(s) 438, 831, 851
HindIII AAGCTT 2 cut(s) 503, 893
HinfI GANTC 3 cut(s) 212, 441, 814
HphI GGTGA 5 cut(s) 121, 334, 415, 508, 727
Hpy166II GTNNAC 2 cut(s) 92, 803
Hpy188I TCNGA 3 cut(s) 145, 511, 552
Hpy188III TCNNGA 4 cut(s) 188, 241, 445, 628
Hpy8I GTNNAC 2 cut(s) 92, 803
Hpy99I CGWCG 1 cut(s) 963
HpyAV CCTTC 2 cut(s) 394, 787
HpyCH4III ACNGT 3 cut(s) 322, 605, 715
HpyCH4IV ACGT 2 cut(s) 245, 632
HpyCH4V TGCA 8 cut(s) 272, 386, 392, 472, 479, 779, 785, 862
HpyF10VI GCNNNNNNNGC 4 cut(s) 460, 469, 850, 859
HpyF3I CTNAG 7 cut(s) 40, 73, 86, 235, 417, 923, 944
HpySE526I ACGT 2 cut(s) 245, 632
Hsp92II CATG 3 cut(s) 438, 831, 851
Kzo9I GATC 1 cut(s) 359
LpnPI CCDG 7 cut(s) 53, 229, 245, 335, 632, 678, 885
LweI GCATC 3 cut(s) 328, 721, 853
MaeI CTAG 3 cut(s) 531, 810, 854
MaeII ACGT 2 cut(s) 245, 632
MaeIII GTNAC 3 cut(s) 403, 455, 870
MalI GATC 1 cut(s) 361
MboI GATC 1 cut(s) 359
MboII GAAGA 4 cut(s) 56, 315, 919, 922
MflI RGATCY 1 cut(s) 359
MhlI GDGCHC 1 cut(s) 163
MluCI AATT 6 cut(s) 45, 139, 370, 579, 637, 788
MlyI GAGTC 1 cut(s) 206
MmeI TCCRAC 2 cut(s) 615, 637
MnlI CCTC 6 cut(s) 244, 297, 631, 684, 834, 939
MseI TTAA 1 cut(s) 582
MslI CAYNNNNRTG 2 cut(s) 352, 745
Mva1269I GAATGC 2 cut(s) 388, 781
MwoI GCNNNNNNNGC 4 cut(s) 460, 469, 850, 859
NdeII GATC 1 cut(s) 359
NlaIII CATG 3 cut(s) 438, 831, 851
NlaIV GGNNCC 1 cut(s) 835
NmuCI GTSAC 2 cut(s) 403, 455
OliI CACNNNNGTG 2 cut(s) 352, 745
PctI GAATGC 2 cut(s) 388, 781
PfeI GAWTC 2 cut(s) 441, 814
Pfl23II CGTACG 2 cut(s) 317, 710
PleI GAGTC 1 cut(s) 206
PpsI GAGTC 1 cut(s) 206
PspLI CGTACG 2 cut(s) 317, 710
PspN4I GGNNCC 1 cut(s) 835
PspPI GGNCC 1 cut(s) 52
PstI CTGCAG 1 cut(s) 394
PsuI RGATCY 1 cut(s) 359
RsaI GTAC 2 cut(s) 319, 712
RsaNI GTAC 2 cut(s) 318, 711
RseI CAYNNNNRTG 2 cut(s) 352, 745
SaqAI TTAA 1 cut(s) 582
Sau3AI GATC 1 cut(s) 359
Sau96I GGNCC 1 cut(s) 52
SchI GAGTC 1 cut(s) 206
SduI GDGCHC 1 cut(s) 163
SfaNI GCATC 3 cut(s) 328, 721, 853
SfcI CTRYAG 2 cut(s) 390, 601
SmiMI CAYNNNNRTG 2 cut(s) 352, 745
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
Sse9I AATT 6 cut(s) 45, 139, 370, 579, 637, 788
SspMI CTAG 3 cut(s) 531, 810, 854
TaaI ACNGT 3 cut(s) 322, 605, 715
TaiI ACGT 2 cut(s) 248, 635
TaqI TCGA 4 cut(s) 380, 773, 817, 961
TasI AATT 6 cut(s) 45, 139, 370, 579, 637, 788
TfiI GAWTC 2 cut(s) 441, 814
Tru1I TTAA 1 cut(s) 582
Tru9I TTAA 1 cut(s) 582
TscAI CASTG 1 cut(s) 223
TseFI GTSAC 2 cut(s) 403, 455
Tsp45I GTSAC 2 cut(s) 403, 455
TspDTI ATGAA 2 cut(s) 284, 671
TspRI CASTG 1 cut(s) 223
XapI RAATTY 2 cut(s) 45, 139
XspI CTAG 3 cut(s) 531, 810, 854
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.