Rroxscaffold_1G00071920

NDR1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0006390
Physical Location & Seq
Reverse (-)
93040892 .. 93041340
449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00071920.1

Sequence Viewer

Length: 417 bp
ATGGTGGATTTCACCATCCCAAAGTCCGATTTGGACATTAATGGGGGTAAAAAAGGTTCCTTGGAATATGGCCTTGAAATAAATTTTTTTAACAAAGGCTCGGTTATTTTCTATGATGACACACTTCTGGCATTCTATCATGGACAGGATACATTTGGGGAGAACAGCATTACTGCATTTCATCAAAGAGGAAGCGATACAGATCAAGTGGTTGATCATGTGGAGGTGCCGAGAAATTCCATATTGAATGGAACTGCAGAACTGAAGGGGGCTTTACGAACTCAGCTTCAATACAAAACCTTGGGAAGAAACAGCAAGCAACATGGGGTAAACTTGCAAGCTGTATTACCAATCGGGCCAGATTGTAAGATTTCTGGTAAGAAGAAGAAAATCAAGCTAAGGCGCCATTTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LEA_2

Protein Analysis

138

Amino Acids

15.44

Weight (kDa)

8.99

Isoelectric Point (pI)

20.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 226, 402
AcsI RAATTY 2 cut(s) 82, 235
AcuI CTGAAG 1 cut(s) 284
AcyI GRCGYC 1 cut(s) 403
AgsI TTSAA 4 cut(s) 77, 247, 290, 413
AluBI AGCT 3 cut(s) 286, 341, 397
AluI AGCT 3 cut(s) 286, 341, 397
AoxI GGCC 2 cut(s) 70, 356
ApoI RAATTY 2 cut(s) 82, 235
AseI ATTAAT 1 cut(s) 39
AspLEI GCGC 1 cut(s) 405
AspS9I GGNCC 1 cut(s) 356
AsuHPI GGTGA 1 cut(s) 4
BanI GGYRCC 2 cut(s) 226, 402
BccI CCATC 1 cut(s) 23
BciVI GTATCC 1 cut(s) 142
BclI TGATCA 1 cut(s) 214
BfmI CTRYAG 1 cut(s) 255
BfoI RGCGCY 1 cut(s) 406
BfuI GTATCC 1 cut(s) 142
BmgT120I GGNCC 1 cut(s) 356
BmiI GGNNCC 3 cut(s) 58, 228, 404
Bpu10I CCTNAGC 1 cut(s) 398
BsaBI GATNNNNATC 1 cut(s) 201
BsaHI GRCGYC 1 cut(s) 403
BsaJI CCNNGG 2 cut(s) 60, 300
Bse8I GATNNNNATC 1 cut(s) 201
BseDI CCNNGG 2 cut(s) 60, 300
BseGI GGATG 1 cut(s) 15
BseJI GATNNNNATC 1 cut(s) 201
BseMII CTCAG 1 cut(s) 296
BshFI GGCC 2 cut(s) 72, 358
BshNI GGYRCC 2 cut(s) 226, 402
BsmI GAATGC 1 cut(s) 131
BsnI GGCC 2 cut(s) 72, 358
Bsp143I GATC 2 cut(s) 202, 214
BspANI GGCC 2 cut(s) 72, 358
BspCNI CTCAG 1 cut(s) 295
BspLI GGNNCC 3 cut(s) 58, 228, 404
BspMAI CTGCAG 1 cut(s) 259
BspT107I GGYRCC 2 cut(s) 226, 402
BssECI CCNNGG 2 cut(s) 60, 300
BssMI GATC 2 cut(s) 202, 214
BssNI GRCGYC 1 cut(s) 403
BssT1I CCWWGG 2 cut(s) 60, 300
BstACI GRCGYC 1 cut(s) 403
BstC8I GCNNGC 2 cut(s) 317, 339
BstDEI CTNAG 2 cut(s) 282, 398
BstF5I GGATG 1 cut(s) 15
BstH2I RGCGCY 1 cut(s) 406
BstHHI GCGC 1 cut(s) 405
BstKTI GATC 2 cut(s) 205, 217
BstMBI GATC 2 cut(s) 202, 214
BstSFI CTRYAG 1 cut(s) 255
BsuI GTATCC 1 cut(s) 142
BsuRI GGCC 2 cut(s) 72, 358
BtsCI GGATG 1 cut(s) 15
Cac8I GCNNGC 2 cut(s) 317, 339
CfoI GCGC 1 cut(s) 405
Cfr13I GGNCC 1 cut(s) 356
CviAII CATG 3 cut(s) 140, 218, 323
CviJI RGCY 7 cut(s) 72, 99, 272, 286, 341, 358, 397
CviKI_1 RGCY 7 cut(s) 72, 99, 272, 286, 341, 358, 397
DdeI CTNAG 2 cut(s) 282, 398
DinI GGCGCC 1 cut(s) 404
DpnI GATC 2 cut(s) 204, 216
DpnII GATC 2 cut(s) 202, 214
Eco130I CCWWGG 2 cut(s) 60, 300
Eco57I CTGAAG 1 cut(s) 284
EcoT14I CCWWGG 2 cut(s) 60, 300
EgeI GGCGCC 1 cut(s) 404
EheI GGCGCC 1 cut(s) 404
ErhI CCWWGG 2 cut(s) 60, 300
FaeI CATG 3 cut(s) 143, 221, 326
FaiI YATR 6 cut(s) 69, 114, 141, 219, 242, 324
FatI CATG 3 cut(s) 139, 217, 322
FbaI TGATCA 1 cut(s) 214
FokI GGATG 1 cut(s) 2
GlaI GCGC 1 cut(s) 404
HaeII RGCGCY 1 cut(s) 406
HaeIII GGCC 2 cut(s) 72, 358
HhaI GCGC 1 cut(s) 405
Hin1I GRCGYC 1 cut(s) 403
Hin1II CATG 3 cut(s) 143, 221, 326
Hin6I GCGC 1 cut(s) 403
HinP1I GCGC 1 cut(s) 403
HphI GGTGA 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 331
Hpy188I TCNGA 1 cut(s) 28
Hpy8I GTNNAC 1 cut(s) 331
HpyAV CCTTC 1 cut(s) 259
HpyCH4V TGCA 3 cut(s) 176, 257, 337
HpyF3I CTNAG 2 cut(s) 282, 398
Hsp92I GRCGYC 1 cut(s) 403
Hsp92II CATG 3 cut(s) 143, 221, 326
HspAI GCGC 1 cut(s) 403
KasI GGCGCC 1 cut(s) 402
Ksp22I TGATCA 1 cut(s) 214
Kzo9I GATC 2 cut(s) 202, 214
LpnPI CCDG 4 cut(s) 113, 131, 360, 372
MalI GATC 2 cut(s) 204, 216
MboI GATC 2 cut(s) 202, 214
MboII GAAGA 3 cut(s) 318, 394, 397
MluCI AATT 2 cut(s) 82, 235
Mly113I GGCGCC 1 cut(s) 403
MnlI CCTC 2 cut(s) 182, 217
MseI TTAA 2 cut(s) 39, 90
Mva1269I GAATGC 1 cut(s) 131
NarI GGCGCC 1 cut(s) 403
NdeII GATC 2 cut(s) 202, 214
NlaIII CATG 3 cut(s) 143, 221, 326
NlaIV GGNNCC 3 cut(s) 58, 228, 404
NmeAIII GCCGAG 1 cut(s) 255
PctI GAATGC 1 cut(s) 131
PluTI GGCGCC 1 cut(s) 406
PshBI ATTAAT 1 cut(s) 39
PspN4I GGNNCC 3 cut(s) 58, 228, 404
PspPI GGNCC 1 cut(s) 356
PsrI GAACNNNNNNTAC 2 cut(s) 40, 72
PstI CTGCAG 1 cut(s) 259
SaqAI TTAA 2 cut(s) 39, 90
Sau3AI GATC 2 cut(s) 202, 214
Sau96I GGNCC 1 cut(s) 356
SetI ASST 6 cut(s) 58, 228, 288, 302, 343, 399
SfcI CTRYAG 1 cut(s) 255
SfoI GGCGCC 1 cut(s) 404
Sse9I AATT 2 cut(s) 82, 235
SspDI GGCGCC 1 cut(s) 402
StyI CCWWGG 2 cut(s) 60, 300
TasI AATT 2 cut(s) 82, 235
Tru1I TTAA 2 cut(s) 39, 90
Tru9I TTAA 2 cut(s) 39, 90
TspDTI ATGAA 1 cut(s) 170
VspI ATTAAT 1 cut(s) 39
XapI RAATTY 2 cut(s) 82, 235
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.