RchiOBHm_Chr5g0004101

NDR1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
2589745 .. 2591120
1376 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28538

Sequence Viewer

Length: 195 bp
ATGGCGATTAGAAATTCCATATTGAATGGAACTGCAGAACTGAAGGGGGCTTTACGAACTCAGCTTCAATACAAAACCTTGGGAAGAAACAGCAAGCATCATGGGGTAAACTTGCAAGCTGTATTACCAATTGGGCCAGATTGTAAGATTTCTGGTAAGAAGAAGAAAATCAAGCTAAGGCGCCATTTTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.18

Weight (kDa)

10.83

Isoelectric Point (pI)

28.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 180
AcsI RAATTY 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 62
AcyI GRCGYC 1 cut(s) 181
AgsI TTSAA 3 cut(s) 25, 68, 191
AluBI AGCT 3 cut(s) 64, 119, 175
AluI AGCT 3 cut(s) 64, 119, 175
AoxI GGCC 1 cut(s) 134
ApoI RAATTY 1 cut(s) 13
AspLEI GCGC 1 cut(s) 183
AspS9I GGNCC 1 cut(s) 134
BanI GGYRCC 1 cut(s) 180
BfmI CTRYAG 1 cut(s) 33
BfoI RGCGCY 1 cut(s) 184
BmgT120I GGNCC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 182
BmsI GCATC 1 cut(s) 106
Bpu10I CCTNAGC 1 cut(s) 176
BsaHI GRCGYC 1 cut(s) 181
BsaJI CCNNGG 1 cut(s) 78
BseDI CCNNGG 1 cut(s) 78
BseMII CTCAG 1 cut(s) 74
BshFI GGCC 1 cut(s) 136
BshNI GGYRCC 1 cut(s) 180
BsnI GGCC 1 cut(s) 136
BspANI GGCC 1 cut(s) 136
BspCNI CTCAG 1 cut(s) 73
BspLI GGNNCC 1 cut(s) 182
BspMAI CTGCAG 1 cut(s) 37
BspT107I GGYRCC 1 cut(s) 180
BssECI CCNNGG 1 cut(s) 78
BssNI GRCGYC 1 cut(s) 181
BssT1I CCWWGG 1 cut(s) 78
BstACI GRCGYC 1 cut(s) 181
BstC8I GCNNGC 2 cut(s) 95, 117
BstDEI CTNAG 2 cut(s) 60, 176
BstH2I RGCGCY 1 cut(s) 184
BstHHI GCGC 1 cut(s) 183
BstSFI CTRYAG 1 cut(s) 33
BsuRI GGCC 1 cut(s) 136
Cac8I GCNNGC 2 cut(s) 95, 117
CfoI GCGC 1 cut(s) 183
Cfr13I GGNCC 1 cut(s) 134
CviAII CATG 1 cut(s) 101
CviJI RGCY 5 cut(s) 50, 64, 119, 136, 175
CviKI_1 RGCY 5 cut(s) 50, 64, 119, 136, 175
DdeI CTNAG 2 cut(s) 60, 176
DinI GGCGCC 1 cut(s) 182
Eco130I CCWWGG 1 cut(s) 78
Eco57I CTGAAG 1 cut(s) 62
EcoT14I CCWWGG 1 cut(s) 78
EgeI GGCGCC 1 cut(s) 182
EheI GGCGCC 1 cut(s) 182
ErhI CCWWGG 1 cut(s) 78
FaeI CATG 1 cut(s) 104
FaiI YATR 2 cut(s) 20, 102
FatI CATG 1 cut(s) 100
GlaI GCGC 1 cut(s) 182
HaeII RGCGCY 1 cut(s) 184
HaeIII GGCC 1 cut(s) 136
HhaI GCGC 1 cut(s) 183
Hin1I GRCGYC 1 cut(s) 181
Hin1II CATG 1 cut(s) 104
Hin6I GCGC 1 cut(s) 181
HinP1I GCGC 1 cut(s) 181
Hpy166II GTNNAC 1 cut(s) 109
Hpy8I GTNNAC 1 cut(s) 109
HpyAV CCTTC 1 cut(s) 37
HpyCH4V TGCA 2 cut(s) 35, 115
HpyF3I CTNAG 2 cut(s) 60, 176
Hsp92I GRCGYC 1 cut(s) 181
Hsp92II CATG 1 cut(s) 104
HspAI GCGC 1 cut(s) 181
KasI GGCGCC 1 cut(s) 180
LpnPI CCDG 2 cut(s) 138, 150
LweI GCATC 1 cut(s) 106
MboII GAAGA 3 cut(s) 96, 172, 175
MfeI CAATTG 1 cut(s) 129
MluCI AATT 2 cut(s) 13, 129
Mly113I GGCGCC 1 cut(s) 181
MunI CAATTG 1 cut(s) 129
NarI GGCGCC 1 cut(s) 181
NlaIII CATG 1 cut(s) 104
NlaIV GGNNCC 1 cut(s) 182
PluTI GGCGCC 1 cut(s) 184
PspN4I GGNNCC 1 cut(s) 182
PspPI GGNCC 1 cut(s) 134
PstI CTGCAG 1 cut(s) 37
Sau96I GGNCC 1 cut(s) 134
SetI ASST 4 cut(s) 66, 80, 121, 177
SfaNI GCATC 1 cut(s) 106
SfcI CTRYAG 1 cut(s) 33
SfoI GGCGCC 1 cut(s) 182
SgeI CNNG 8 cut(s) 91, 106, 113, 124, 128, 149, 165, 184
Sse9I AATT 2 cut(s) 13, 129
SspDI GGCGCC 1 cut(s) 180
StyI CCWWGG 1 cut(s) 78
TasI AATT 2 cut(s) 13, 129
XapI RAATTY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.