Rh5DG036200

NDR1-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
2539201 .. 2539443
243 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG036200.1

Sequence Viewer

Length: 243 bp
ATGGATGCCAATCCACAAGTGTGGAGAGCTGTTCGCAAATCAATATCGAATGCAAGTGCAGAATTGAAGGTGAGTTTACTAACTAGGATTCGATACACAACATGGGGAGCCAAGAGGCATCATGTGCTAGACTTGCAAGGTTTGTTAACAATAGGTAAAGACGGCAAGCTTTCTGGTAAGAAGAAGAAAATCAAGCTAAGATATGCTTCCAAGAAACTGAAGAAGAATAGTCTTCGATATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.16

Weight (kDa)

10.98

Isoelectric Point (pI)

9.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 239
AgsI TTSAA 1 cut(s) 67
AleI CACNNNNGTG 1 cut(s) 19
AluBI AGCT 3 cut(s) 29, 169, 196
AluI AGCT 3 cut(s) 29, 169, 196
AsuHPI GGTGA 1 cut(s) 82
BbsI GAAGAC 1 cut(s) 224
BceAI ACGGC 1 cut(s) 178
BfaI CTAG 2 cut(s) 84, 128
BmiI GGNNCC 1 cut(s) 109
BmsI GCATC 1 cut(s) 127
BpiI GAAGAC 1 cut(s) 224
BsaBI GATNNNNATC 1 cut(s) 9
Bse8I GATNNNNATC 1 cut(s) 9
BseGI GGATG 1 cut(s) 10
BseJI GATNNNNATC 1 cut(s) 9
BsgI GTGCAG 1 cut(s) 78
BsmI GAATGC 1 cut(s) 55
BspLI GGNNCC 1 cut(s) 109
BstAPI GCANNNNNTGC 1 cut(s) 124
BstC8I GCNNGC 1 cut(s) 167
BstDEI CTNAG 1 cut(s) 197
BstF5I GGATG 1 cut(s) 10
BstMWI GCNNNNNNNGC 2 cut(s) 124, 133
BstV2I GAAGAC 1 cut(s) 224
BstXI CCANNNNNNTGG 1 cut(s) 21
BtsCI GGATG 1 cut(s) 10
Cac8I GCNNGC 1 cut(s) 167
CviAII CATG 2 cut(s) 102, 122
CviJI RGCY 4 cut(s) 29, 110, 169, 196
CviKI_1 RGCY 4 cut(s) 29, 110, 169, 196
DdeI CTNAG 1 cut(s) 197
Eco57I CTGAAG 1 cut(s) 239
FaeI CATG 2 cut(s) 105, 125
FaiI YATR 3 cut(s) 103, 123, 204
FalI AAGNNNNNCTT 2 cut(s) 190, 222
FatI CATG 2 cut(s) 101, 121
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 84, 128
Hin1II CATG 2 cut(s) 105, 125
HincII GTYRAC 1 cut(s) 147
HindII GTYRAC 1 cut(s) 147
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 1 cut(s) 88
HpaI GTTAAC 1 cut(s) 147
HphI GGTGA 1 cut(s) 82
Hpy166II GTNNAC 2 cut(s) 77, 147
Hpy8I GTNNAC 2 cut(s) 77, 147
HpyAV CCTTC 1 cut(s) 61
HpyCH4V TGCA 3 cut(s) 53, 59, 136
HpyF10VI GCNNNNNNNGC 2 cut(s) 124, 133
HpyF3I CTNAG 1 cut(s) 197
Hsp92II CATG 2 cut(s) 105, 125
KspAI GTTAAC 1 cut(s) 147
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 1 cut(s) 159
LweI GCATC 1 cut(s) 127
MaeI CTAG 2 cut(s) 84, 128
MboII GAAGA 5 cut(s) 193, 196, 224, 232, 235
MluCI AATT 1 cut(s) 62
MnlI CCTC 1 cut(s) 108
MseI TTAA 1 cut(s) 146
MslI CAYNNNNRTG 1 cut(s) 19
Mva1269I GAATGC 1 cut(s) 55
MwoI GCNNNNNNNGC 2 cut(s) 124, 133
NlaIII CATG 2 cut(s) 105, 125
NlaIV GGNNCC 1 cut(s) 109
OliI CACNNNNGTG 1 cut(s) 19
PctI GAATGC 1 cut(s) 55
PfeI GAWTC 1 cut(s) 88
PspN4I GGNNCC 1 cut(s) 109
RseI CAYNNNNRTG 1 cut(s) 19
SaqAI TTAA 1 cut(s) 146
SetI ASST 6 cut(s) 31, 72, 142, 157, 171, 198
SfaNI GCATC 1 cut(s) 127
SmiMI CAYNNNNRTG 1 cut(s) 19
Sse9I AATT 1 cut(s) 62
SspMI CTAG 2 cut(s) 84, 128
TaqI TCGA 3 cut(s) 47, 91, 235
TasI AATT 1 cut(s) 62
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
XspI CTAG 2 cut(s) 84, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.