RchiOBHm_Chr4g0397811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
14201246 .. 14203126
1881 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 237 bp
ATGAAGTTCCGTTTTCCCTGCTCAAAGTCTTTATCTTCTCCAGCAGGAATCATCGATGATAGTAACTTAGCTGTATCTGGTATGCAGACAGTATCAGAGGGGAGCTCAAGTGGAATTGATGCTTCTGAAGTTTCGTCGGAGCTAAAATCAAATGGACAAGTTGTGGATGAAAGTCTATTCAAAGATAGCAAGATGGATGTGACTGAGGTACAGATAGATAGTTCAATGCAAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.27

Weight (kDa)

4.39

Isoelectric Point (pI)

42.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 147
AfaI GTAC 1 cut(s) 210
AgsI TTSAA 2 cut(s) 181, 225
AluBI AGCT 3 cut(s) 71, 105, 142
AluI AGCT 3 cut(s) 71, 105, 142
Alw21I GWGCWC 1 cut(s) 107
BanII GRGCYC 1 cut(s) 107
Bbv12I GWGCWC 1 cut(s) 107
BccI CCATC 1 cut(s) 187
BmsI GCATC 1 cut(s) 109
BplI GAGNNNNNCTC 2 cut(s) 89, 121
BpmI CTGGAG 1 cut(s) 24
BpuEI CTTGAG 1 cut(s) 91
Bsa29I ATCGAT 1 cut(s) 54
BsaXI ACNNNNNCTCC 2 cut(s) 94, 124
BseCI ATCGAT 1 cut(s) 54
BseGI GGATG 2 cut(s) 172, 202
BseMII CTCAG 1 cut(s) 195
BshVI ATCGAT 1 cut(s) 54
BsiHKAI GWGCWC 1 cut(s) 107
Bsp1286I GDGCHC 1 cut(s) 107
BspCNI CTCAG 1 cut(s) 196
BspDI ATCGAT 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 91
BstDEI CTNAG 2 cut(s) 67, 204
BstF5I GGATG 2 cut(s) 172, 202
Bsu15I ATCGAT 1 cut(s) 54
BsuTUI ATCGAT 1 cut(s) 54
BtsCI GGATG 2 cut(s) 172, 202
ClaI ATCGAT 1 cut(s) 54
Csp6I GTAC 1 cut(s) 209
CviJI RGCY 3 cut(s) 71, 105, 142
CviKI_1 RGCY 3 cut(s) 71, 105, 142
CviQI GTAC 1 cut(s) 209
DdeI CTNAG 2 cut(s) 67, 204
Ecl136II GAGCTC 1 cut(s) 105
Eco24I GRGCYC 1 cut(s) 107
Eco53kI GAGCTC 1 cut(s) 105
Eco57I CTGAAG 1 cut(s) 147
EcoICRI GAGCTC 1 cut(s) 105
EcoT38I GRGCYC 1 cut(s) 107
FaiI YATR 1 cut(s) 83
FokI GGATG 2 cut(s) 179, 209
FriOI GRGCYC 1 cut(s) 107
GsuI CTGGAG 1 cut(s) 24
HinfI GANTC 1 cut(s) 48
Hpy188I TCNGA 3 cut(s) 97, 127, 139
Hpy99I CGWCG 1 cut(s) 139
HpyCH4III ACNGT 1 cut(s) 91
HpyCH4V TGCA 2 cut(s) 85, 229
HpyF3I CTNAG 2 cut(s) 67, 204
LmnI GCTCC 2 cut(s) 102, 139
LpnPI CCDG 4 cut(s) 30, 31, 54, 63
LweI GCATC 1 cut(s) 109
MaeIII GTNAC 2 cut(s) 62, 199
MboII GAAGA 1 cut(s) 27
MhlI GDGCHC 1 cut(s) 107
MluCI AATT 1 cut(s) 114
MmeI TCCRAC 1 cut(s) 117
MnlI CCTC 2 cut(s) 91, 199
NmuCI GTSAC 1 cut(s) 199
PfeI GAWTC 1 cut(s) 48
Psp124BI GAGCTC 1 cut(s) 107
RsaI GTAC 1 cut(s) 210
RsaNI GTAC 1 cut(s) 209
SacI GAGCTC 1 cut(s) 107
SduI GDGCHC 1 cut(s) 107
SetI ASST 4 cut(s) 73, 107, 144, 210
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 7 cut(s) 30, 53, 57, 90, 120, 170, 202
SmlI CTYRAG 1 cut(s) 106
SmoI CTYRAG 1 cut(s) 106
Sse9I AATT 1 cut(s) 114
SstI GAGCTC 1 cut(s) 107
TaaI ACNGT 1 cut(s) 91
TaqI TCGA 1 cut(s) 54
TasI AATT 1 cut(s) 114
TfiI GAWTC 1 cut(s) 48
TseFI GTSAC 1 cut(s) 199
Tsp45I GTSAC 1 cut(s) 199
TspDTI ATGAA 2 cut(s) 17, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.