RchiOBHm_Chr3g0488871

Belongs to the TrpA family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
36605975 .. 36607887
1913 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 333 bp
ATGGCTTCTCTGACCACCACCAACACCAGCGTCGGCCTCTCCAAAACTTTCATCAAACTGAAGGAGCAAGGCAAGGTTGCATTAATCCCTTACACTACTGCCGGTGATCCTGATCTATCAGTCACCGCAGAAGCATTGAAGGTCCTAGATTCTTGTGGATCGAACATAATTGAATTAGGCGTGCCATACTCTGATCCATTAGTAGCTGGGCTAGTTATACAGACTGTAGCCACTCGTGCCTTGGCAAGAGGGACCAATTTGAATTCAATCCTGGCAATGTTGAAGGAGGTACCTTTACATGCAATCTTTTATTATCTGATCAATCTCTTGTAA

Protein Analysis

110

Amino Acids

11.66

Weight (kDa)

6.54

Isoelectric Point (pI)

21.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Trp_syntA PF00290 17 - 97 3e-25 Tryptophan synthase alpha chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 289
AccB1I GGYRCC 1 cut(s) 289
AciI CCGC 1 cut(s) 126
AclWI GGATC 3 cut(s) 101, 166, 188
AcsI RAATTY 1 cut(s) 262
AcuI CTGAAG 1 cut(s) 80
AfaI GTAC 1 cut(s) 291
AgsI TTSAA 5 cut(s) 139, 173, 262, 267, 283
AjnI CCWGG 1 cut(s) 270
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AlwI GGATC 3 cut(s) 101, 166, 188
AoxI GGCC 1 cut(s) 34
ApoI RAATTY 1 cut(s) 262
AseI ATTAAT 1 cut(s) 83
Asp718I GGTACC 1 cut(s) 289
AspS9I GGNCC 2 cut(s) 142, 252
AsuHPI GGTGA 2 cut(s) 115, 116
AvaII GGWCC 2 cut(s) 142, 252
BanI GGYRCC 1 cut(s) 289
BauI CACGAG 1 cut(s) 234
BciT130I CCWGG 1 cut(s) 272
BclI TGATCA 1 cut(s) 318
BfaI CTAG 2 cut(s) 146, 212
BfmI CTRYAG 1 cut(s) 225
Bme1390I CCNGG 1 cut(s) 272
Bme18I GGWCC 2 cut(s) 142, 252
BmgT120I GGNCC 2 cut(s) 142, 252
BmiI GGNNCC 2 cut(s) 253, 291
BmrFI CCNGG 1 cut(s) 272
BsaBI GATNNNNATC 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 240
Bse118I RCCGGY 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 282
Bse8I GATNNNNATC 1 cut(s) 111
BseBI CCWGG 1 cut(s) 272
BseDI CCNNGG 1 cut(s) 240
BseJI GATNNNNATC 1 cut(s) 111
BseMI GCAATG 1 cut(s) 282
BseYI CCCAGC 1 cut(s) 206
BshFI GGCC 1 cut(s) 36
BshNI GGYRCC 1 cut(s) 289
BsiSI CCGG 1 cut(s) 102
BslFI GGGAC 1 cut(s) 265
BsmFI GGGAC 1 cut(s) 265
BsnI GGCC 1 cut(s) 36
Bsp143I GATC 5 cut(s) 106, 112, 158, 193, 318
BspACI CCGC 1 cut(s) 126
BspANI GGCC 1 cut(s) 36
BspLI GGNNCC 2 cut(s) 253, 291
BspPI GGATC 3 cut(s) 101, 166, 188
BspT107I GGYRCC 1 cut(s) 289
BsrDI GCAATG 1 cut(s) 282
BsrFI RCCGGY 1 cut(s) 101
BssAI RCCGGY 1 cut(s) 101
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 5 cut(s) 106, 112, 158, 193, 318
BssSI CACGAG 1 cut(s) 234
BssT1I CCWWGG 1 cut(s) 240
Bst2BI CACGAG 1 cut(s) 234
Bst2UI CCWGG 1 cut(s) 272
Bst4CI ACNGT 1 cut(s) 226
BstC8I GCNNGC 1 cut(s) 182
BstKTI GATC 5 cut(s) 109, 115, 161, 196, 321
BstMBI GATC 5 cut(s) 106, 112, 158, 193, 318
BstMWI GCNNNNNNNGC 1 cut(s) 236
BstNI CCWGG 1 cut(s) 272
BstNSI RCATGY 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 270
BstSFI CTRYAG 1 cut(s) 225
BsuRI GGCC 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 182
Cfr10I RCCGGY 1 cut(s) 101
Cfr13I GGNCC 2 cut(s) 142, 252
CseI GACGC 1 cut(s) 19
Csp6I GTAC 1 cut(s) 290
CviAII CATG 1 cut(s) 299
CviJI RGCY 5 cut(s) 5, 36, 206, 211, 230
CviKI_1 RGCY 5 cut(s) 5, 36, 206, 211, 230
CviQI GTAC 1 cut(s) 290
DpnI GATC 5 cut(s) 108, 114, 160, 195, 320
DpnII GATC 5 cut(s) 106, 112, 158, 193, 318
Eco130I CCWWGG 1 cut(s) 240
Eco47I GGWCC 2 cut(s) 142, 252
Eco57I CTGAAG 1 cut(s) 80
EcoO109I RGGNCCY 1 cut(s) 142
EcoRI GAATTC 1 cut(s) 262
EcoRII CCWGG 1 cut(s) 270
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
FaeI CATG 1 cut(s) 302
FaiI YATR 4 cut(s) 167, 187, 218, 300
FaqI GGGAC 1 cut(s) 265
FatI CATG 1 cut(s) 298
FbaI TGATCA 1 cut(s) 318
FspBI CTAG 2 cut(s) 146, 212
GsaI CCCAGC 1 cut(s) 210
HaeIII GGCC 1 cut(s) 36
HapII CCGG 1 cut(s) 102
HgaI GACGC 1 cut(s) 19
Hin1II CATG 1 cut(s) 302
HinfI GANTC 1 cut(s) 149
HpaII CCGG 1 cut(s) 102
HphI GGTGA 2 cut(s) 115, 116
Hpy188I TCNGA 3 cut(s) 12, 193, 318
Hpy188III TCNNGA 1 cut(s) 110
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 3 cut(s) 55, 133, 277
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4V TGCA 2 cut(s) 80, 302
HpyF10VI GCNNNNNNNGC 1 cut(s) 236
Hsp92II CATG 1 cut(s) 302
KpnI GGTACC 1 cut(s) 293
Ksp22I TGATCA 1 cut(s) 318
Kzo9I GATC 5 cut(s) 106, 112, 158, 193, 318
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 6 cut(s) 40, 115, 123, 192, 257, 284
MaeI CTAG 2 cut(s) 146, 212
MaeIII GTNAC 1 cut(s) 121
MalI GATC 5 cut(s) 108, 114, 160, 195, 320
MboI GATC 5 cut(s) 106, 112, 158, 193, 318
MluCI AATT 4 cut(s) 168, 173, 256, 262
MnlI CCTC 3 cut(s) 47, 242, 280
MseI TTAA 1 cut(s) 83
MspI CCGG 1 cut(s) 102
MspR9I CCNGG 1 cut(s) 272
MvaI CCWGG 1 cut(s) 272
MwoI GCNNNNNNNGC 1 cut(s) 236
NdeII GATC 5 cut(s) 106, 112, 158, 193, 318
NlaIII CATG 1 cut(s) 302
NlaIV GGNNCC 2 cut(s) 253, 291
NmuCI GTSAC 1 cut(s) 121
NspI RCATGY 1 cut(s) 302
PfeI GAWTC 1 cut(s) 149
PpuMI RGGWCCY 1 cut(s) 142
PshBI ATTAAT 1 cut(s) 83
Psp5II RGGWCCY 1 cut(s) 142
Psp6I CCWGG 1 cut(s) 270
PspFI CCCAGC 1 cut(s) 206
PspGI CCWGG 1 cut(s) 270
PspN4I GGNNCC 2 cut(s) 253, 291
PspPI GGNCC 2 cut(s) 142, 252
PspPPI RGGWCCY 1 cut(s) 142
RsaI GTAC 1 cut(s) 291
RsaNI GTAC 1 cut(s) 290
SaqAI TTAA 1 cut(s) 83
Sau3AI GATC 5 cut(s) 106, 112, 158, 193, 318
Sau96I GGNCC 2 cut(s) 142, 252
ScrFI CCNGG 1 cut(s) 272
SetI ASST 5 cut(s) 78, 144, 208, 291, 295
SfcI CTRYAG 1 cut(s) 225
SinI GGWCC 2 cut(s) 142, 252
Sse9I AATT 4 cut(s) 168, 173, 256, 262
SsiI CCGC 1 cut(s) 126
SspMI CTAG 2 cut(s) 146, 212
StyD4I CCNGG 1 cut(s) 270
StyI CCWWGG 1 cut(s) 240
TaaI ACNGT 1 cut(s) 226
TaqI TCGA 1 cut(s) 161
TasI AATT 4 cut(s) 168, 173, 256, 262
TfiI GAWTC 1 cut(s) 149
Tru1I TTAA 1 cut(s) 83
Tru9I TTAA 1 cut(s) 83
TseFI GTSAC 1 cut(s) 121
Tsp45I GTSAC 1 cut(s) 121
TspDTI ATGAA 1 cut(s) 40
VpaK11BI GGWCC 2 cut(s) 142, 252
VspI ATTAAT 1 cut(s) 83
XapI RAATTY 1 cut(s) 262
XceI RCATGY 1 cut(s) 302
XcmI CCANNNNNNNNNTGG 1 cut(s) 238
XspI CTAG 2 cut(s) 146, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.