RchiOBHm_Chr1g0314271

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
1553231 .. 1553565
335 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 207 bp
ATGGCCAAACTTTCAGCTCTTCTAAATTGCTTCTTTCCTTCATCATCATCACAAGTTTCCGATGATGCAGGAAATACCAGTTACATTGCGAAAGCTCCCTCTTCAAACGAATCCAGAAAAAGTAAATCTATGAAATCCACATCATCGTCGGGAGCTCCAATAATAGTTTCTCATTTCCCCCATAACTCATACATTTCTCGCCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.21

Weight (kDa)

9.65

Isoelectric Point (pI)

51.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AgsI TTSAA 1 cut(s) 105
AjuI GAANNNNNNNTTGG 2 cut(s) 151, 183
AluBI AGCT 3 cut(s) 17, 95, 155
AluI AGCT 3 cut(s) 17, 95, 155
Alw21I GWGCWC 1 cut(s) 157
AoxI GGCC 1 cut(s) 3
BalI TGGCCA 1 cut(s) 5
BanII GRGCYC 1 cut(s) 157
Bbv12I GWGCWC 1 cut(s) 157
BmsI GCATC 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 78
Bse3DI GCAATG 1 cut(s) 84
BseMI GCAATG 1 cut(s) 84
BseNI ACTGG 1 cut(s) 78
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 157
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 1 cut(s) 157
BspANI GGCC 1 cut(s) 5
BspQI GCTCTTC 1 cut(s) 24
BsrDI GCAATG 1 cut(s) 84
BsrI ACTGG 1 cut(s) 78
Bst6I CTCTTC 2 cut(s) 24, 106
BsuRI GGCC 1 cut(s) 5
CviJI RGCY 4 cut(s) 5, 17, 95, 155
CviKI_1 RGCY 4 cut(s) 5, 17, 95, 155
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 2 cut(s) 24, 106
EarI CTCTTC 2 cut(s) 24, 106
Ecl136II GAGCTC 1 cut(s) 155
Eco24I GRGCYC 1 cut(s) 157
Eco53kI GAGCTC 1 cut(s) 155
EcoICRI GAGCTC 1 cut(s) 155
EcoT38I GRGCYC 1 cut(s) 157
FaiI YATR 3 cut(s) 131, 183, 190
FriOI GRGCYC 1 cut(s) 157
HaeIII GGCC 1 cut(s) 5
HinfI GANTC 1 cut(s) 110
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 114, 150
Hpy99I CGWCG 1 cut(s) 151
HpyAV CCTTC 1 cut(s) 48
HpyCH4V TGCA 1 cut(s) 68
LguI GCTCTTC 1 cut(s) 24
LmnI GCTCC 3 cut(s) 100, 152, 160
LpnPI CCDG 3 cut(s) 54, 91, 127
LweI GCATC 1 cut(s) 55
MaeIII GTNAC 1 cut(s) 80
MboII GAAGA 2 cut(s) 11, 93
MhlI GDGCHC 1 cut(s) 157
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 25
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 109
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
PciSI GCTCTTC 1 cut(s) 24
PfeI GAWTC 1 cut(s) 110
Psp124BI GAGCTC 1 cut(s) 157
SacI GAGCTC 1 cut(s) 157
SapI GCTCTTC 1 cut(s) 24
SduI GDGCHC 1 cut(s) 157
SetI ASST 3 cut(s) 19, 97, 157
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 5 cut(s) 65, 81, 90, 126, 162
Sse9I AATT 1 cut(s) 25
SstI GAGCTC 1 cut(s) 157
TasI AATT 1 cut(s) 25
TfiI GAWTC 1 cut(s) 110
TspDTI ATGAA 2 cut(s) 30, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.