RchiOBHm_Chr1g0331871

Splicing factor 3B subunit

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
22883756 .. 22884167
412 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 144 bp
ATGTCGGCAATCTCGACCCTCAGGTTAGTGAAGAATTGTTGTGGGAGCTGTTTGTTCAAACTGGTCTTGTTGGTATTTAATATCTATGTTCCCAAAGATAGAATTACGAACCTTCATCAAGGACACGGATTCGTGAAGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

47

Amino Acids

5.33

Weight (kDa)

9.65

Isoelectric Point (pI)

33.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 58
AluBI AGCT 1 cut(s) 48
AluI AGCT 1 cut(s) 48
AxyI CCTNAGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 66
Bse21I CCTNAGG 1 cut(s) 20
BseMII CTCAG 1 cut(s) 34
BseNI ACTGG 1 cut(s) 66
BspCNI CTCAG 1 cut(s) 33
BsrI ACTGG 1 cut(s) 66
BstDEI CTNAG 1 cut(s) 20
Bsu36I CCTNAGG 1 cut(s) 20
CviJI RGCY 1 cut(s) 48
CviKI_1 RGCY 1 cut(s) 48
DdeI CTNAG 1 cut(s) 20
Eco81I CCTNAGG 1 cut(s) 20
FaiI YATR 1 cut(s) 87
HinfI GANTC 1 cut(s) 129
Hpy188I TCNGA 1 cut(s) 143
Hpy188III TCNNGA 2 cut(s) 13, 133
HpyAV CCTTC 1 cut(s) 122
HpyF3I CTNAG 1 cut(s) 20
LmnI GCTCC 1 cut(s) 45
LpnPI CCDG 2 cut(s) 7, 47
MboII GAAGA 1 cut(s) 43
MluCI AATT 2 cut(s) 34, 102
MnlI CCTC 1 cut(s) 29
MseI TTAA 1 cut(s) 78
PcsI WCGNNNNNNNCGW 1 cut(s) 11
PfeI GAWTC 1 cut(s) 129
SaqAI TTAA 1 cut(s) 78
SetI ASST 3 cut(s) 26, 50, 114
SgeI CNNG 6 cut(s) 25, 34, 74, 79, 131, 137
Sse9I AATT 2 cut(s) 34, 102
TaqI TCGA 1 cut(s) 14
TasI AATT 2 cut(s) 34, 102
TfiI GAWTC 1 cut(s) 129
Tru1I TTAA 1 cut(s) 78
Tru9I TTAA 1 cut(s) 78
TspDTI ATGAA 1 cut(s) 104
TspGWI ACGGA 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.