Rmu_sc0000048.1_g000030

Splicing factor 3B subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000048.1
OG0008898
Physical Location & Seq
Forward (+)
129000 .. 134238
5239 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000048.1_g000030.1.cds

Sequence Viewer

Length: 528 bp
atggaactctatgcttattttcgtgcagttaatgtgtatgttcctaaagatagagttatgaacctccatcaaggatacagattcgtggagttccgaagtgaacaggatgctgattacataagttttcctattctcaagttattatatagctccccgattcctgttaaagatgttgtttctgactataaatttgttgttttgactgccatgcctgcaatcaaggtgcttaatatgatcaagctttatggaaaggcaattcgtgtaaataaggtgaatcttgttgagtggctaaaaataatggtaggtgcaagaagtatggagtatgatgaatgggccaatcacagccacctcccaatgttgggatcccccctcgcctccatcgtcgccgacgccatctcccaaacacaagcagatcccaatcagctcgaaaattggaatcacagtcaacgcaggaatcctgatgaggctaggaaacctgaaggcattaggagaccacatgatgacatgggagatattttgggagattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
RRM_1

Protein Analysis

175

Amino Acids

20.16

Weight (kDa)

6.52

Isoelectric Point (pI)

34.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 357, 370, 407
AcsI RAATTY 1 cut(s) 188
AcuI CTGAAG 1 cut(s) 498
AcyI GRCGYC 1 cut(s) 390
AfiI CCNNNNNNNGG 2 cut(s) 358, 359
AluBI AGCT 3 cut(s) 150, 241, 424
AluI AGCT 3 cut(s) 150, 241, 424
Alw26I GTCTC 1 cut(s) 484
AlwI GGATC 3 cut(s) 357, 370, 407
AoxI GGCC 1 cut(s) 333
ApoI RAATTY 1 cut(s) 188
ArsI GACNNNNNNTTYG 2 cut(s) 173, 205
AspS9I GGNCC 1 cut(s) 333
AsuHPI GGTGA 1 cut(s) 283
BamHI GGATCC 1 cut(s) 362
BccI CCATC 3 cut(s) 75, 386, 401
BciVI GTATCC 1 cut(s) 68
BclI TGATCA 1 cut(s) 234
BcoDI GTCTC 1 cut(s) 484
BfaI CTAG 1 cut(s) 468
BfuI GTATCC 1 cut(s) 68
BmgT120I GGNCC 1 cut(s) 333
BmiI GGNNCC 1 cut(s) 364
BmsI GCATC 1 cut(s) 97
BpuEI CTTGAG 1 cut(s) 119
BsaBI GATNNNNATC 1 cut(s) 417
BsaHI GRCGYC 1 cut(s) 390
BsaI GGTCTC 1 cut(s) 484
BsaXI ACNNNNNCTCC 2 cut(s) 380, 410
Bsc4I CCNNNNNNNGG 2 cut(s) 358, 359
Bse8I GATNNNNATC 1 cut(s) 417
BseGI GGATG 1 cut(s) 112
BseJI GATNNNNATC 1 cut(s) 417
BseLI CCNNNNNNNGG 2 cut(s) 358, 359
BsgI GTGCAG 1 cut(s) 45
BshFI GGCC 1 cut(s) 335
BslI CCNNNNNNNGG 2 cut(s) 358, 359
BsmAI GTCTC 1 cut(s) 484
BsnI GGCC 1 cut(s) 335
Bso31I GGTCTC 1 cut(s) 484
Bsp143I GATC 3 cut(s) 234, 362, 412
BspANI GGCC 1 cut(s) 335
BspLI GGNNCC 1 cut(s) 364
BspPI GGATC 3 cut(s) 357, 370, 407
BspTNI GGTCTC 1 cut(s) 484
BssMI GATC 3 cut(s) 234, 362, 412
BssNI GRCGYC 1 cut(s) 390
Bst4CI ACNGT 1 cut(s) 443
BstACI GRCGYC 1 cut(s) 390
BstC8I GCNNGC 1 cut(s) 213
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 3 cut(s) 237, 365, 415
BstMAI GTCTC 1 cut(s) 484
BstMBI GATC 3 cut(s) 234, 362, 412
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstX2I RGATCY 2 cut(s) 362, 412
BstYI RGATCY 2 cut(s) 362, 412
BsuI GTATCC 1 cut(s) 68
BsuRI GGCC 1 cut(s) 335
BtsCI GGATG 1 cut(s) 112
Cac8I GCNNGC 1 cut(s) 213
Cfr13I GGNCC 1 cut(s) 333
CseI GACGC 1 cut(s) 398
CviAII CATG 3 cut(s) 208, 497, 505
CviJI RGCY 7 cut(s) 150, 241, 289, 335, 345, 424, 467
CviKI_1 RGCY 7 cut(s) 150, 241, 289, 335, 345, 424, 467
DpnI GATC 3 cut(s) 236, 364, 414
DpnII GATC 3 cut(s) 234, 362, 412
Eco31I GGTCTC 1 cut(s) 484
Eco57I CTGAAG 1 cut(s) 498
FaeI CATG 3 cut(s) 211, 500, 508
FatI CATG 3 cut(s) 207, 496, 504
FbaI TGATCA 1 cut(s) 234
FokI GGATG 1 cut(s) 119
FspBI CTAG 1 cut(s) 468
HaeIII GGCC 1 cut(s) 335
HgaI GACGC 1 cut(s) 398
Hin1I GRCGYC 1 cut(s) 390
Hin1II CATG 3 cut(s) 211, 500, 508
HincII GTYRAC 1 cut(s) 446
HindII GTYRAC 1 cut(s) 446
HindIII AAGCTT 1 cut(s) 239
HinfI GANTC 5 cut(s) 81, 157, 274, 436, 454
HphI GGTGA 1 cut(s) 283
Hpy166II GTNNAC 2 cut(s) 101, 446
Hpy188I TCNGA 2 cut(s) 95, 181
Hpy188III TCNNGA 1 cut(s) 458
Hpy8I GTNNAC 2 cut(s) 101, 446
Hpy99I CGWCG 2 cut(s) 386, 392
HpyAV CCTTC 1 cut(s) 473
HpyCH4III ACNGT 1 cut(s) 443
HpyCH4V TGCA 3 cut(s) 26, 215, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
Hsp92I GRCGYC 1 cut(s) 390
Hsp92II CATG 3 cut(s) 211, 500, 508
Ksp22I TGATCA 1 cut(s) 234
Kzo9I GATC 3 cut(s) 234, 362, 412
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 6 cut(s) 89, 174, 225, 436, 471, 489
LweI GCATC 1 cut(s) 97
MaeI CTAG 1 cut(s) 468
MalI GATC 3 cut(s) 236, 364, 414
MboI GATC 3 cut(s) 234, 362, 412
MflI RGATCY 2 cut(s) 362, 412
MluCI AATT 3 cut(s) 188, 255, 430
MnlI CCTC 5 cut(s) 74, 359, 380, 385, 457
MseI TTAA 4 cut(s) 30, 165, 228, 526
MwoI GCNNNNNNNGC 1 cut(s) 212
NdeII GATC 3 cut(s) 234, 362, 412
NlaIII CATG 3 cut(s) 211, 500, 508
NlaIV GGNNCC 1 cut(s) 364
PcsI WCGNNNNNNNCGW 1 cut(s) 378
PfeI GAWTC 5 cut(s) 81, 157, 274, 436, 454
PspN4I GGNNCC 1 cut(s) 364
PspPI GGNCC 1 cut(s) 333
PsuI RGATCY 2 cut(s) 362, 412
SaqAI TTAA 4 cut(s) 30, 165, 228, 526
Sau3AI GATC 3 cut(s) 234, 362, 412
Sau96I GGNCC 1 cut(s) 333
SetI ASST 9 cut(s) 66, 152, 225, 243, 273, 307, 351, 426, 478
SfaNI GCATC 1 cut(s) 97
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
Sse9I AATT 3 cut(s) 188, 255, 430
SspMI CTAG 1 cut(s) 468
TaaI ACNGT 1 cut(s) 443
TaqI TCGA 1 cut(s) 426
TasI AATT 3 cut(s) 188, 255, 430
TfiI GAWTC 5 cut(s) 81, 157, 274, 436, 454
Tru1I TTAA 4 cut(s) 30, 165, 228, 526
Tru9I TTAA 4 cut(s) 30, 165, 228, 526
TspDTI ATGAA 2 cut(s) 74, 342
XapI RAATTY 1 cut(s) 188
XspI CTAG 1 cut(s) 468
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.