Rmu_co8468775.1_g000001

Splicing factor 3B subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8468775.1
OG0008898
Physical Location & Seq
Reverse (-)
328 .. 967
640 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8468775.1_g000001.1.cds

Sequence Viewer

Length: 366 bp
atgactagaatagctcttggagtcggagccaacttgctcggtcaacattccgctgagagaaaccaagacactactctttacgtctgcaatctcgaccctcaggtcagtgaagaattgttgtgggagctttttgttcaagttggccctgttgtcaaagtgtttttcagagcaaacatacaaaaaggagataatatggaggaaagatgtgcaaataaagaaaagcttgaagtcctggtcctagcaagtgaccttgatggatcaaggagctcaatccatggagatatcgcaacaaattatggagatattcgcagaagtattgatgatgacatggcaaattctcattggataaagtgtggagaatcctaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
RRM_1

Protein Analysis

121

Amino Acids

13.48

Weight (kDa)

4.82

Isoelectric Point (pI)

36.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 101
AciI CCGC 1 cut(s) 51
AclWI GGATC 1 cut(s) 265
AcsI RAATTY 1 cut(s) 334
AgsI TTSAA 2 cut(s) 137, 227
AjnI CCWGG 1 cut(s) 231
AluBI AGCT 4 cut(s) 14, 127, 223, 267
AluI AGCT 4 cut(s) 14, 127, 223, 267
Alw21I GWGCWC 1 cut(s) 269
AlwI GGATC 1 cut(s) 265
AoxI GGCC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 334
AspS9I GGNCC 2 cut(s) 143, 235
AvaII GGWCC 1 cut(s) 235
AxyI CCTNAGG 1 cut(s) 99
BanII GRGCYC 1 cut(s) 269
Bbv12I GWGCWC 1 cut(s) 269
BccI CCATC 1 cut(s) 248
BciT130I CCWGG 1 cut(s) 233
BfaI CTAG 2 cut(s) 6, 239
Bme1390I CCNGG 1 cut(s) 233
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 2 cut(s) 143, 235
BmiI GGNNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 233
BsaJI CCNNGG 1 cut(s) 274
Bse21I CCTNAGG 1 cut(s) 99
BseBI CCWGG 1 cut(s) 233
BseDI CCNNGG 1 cut(s) 274
BseMII CTCAG 2 cut(s) 45, 113
BshFI GGCC 1 cut(s) 144
BsiHKAI GWGCWC 1 cut(s) 269
BsnI GGCC 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 269
Bsp143I GATC 1 cut(s) 257
Bsp19I CCATGG 1 cut(s) 274
BspACI CCGC 1 cut(s) 51
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 2 cut(s) 46, 112
BspLI GGNNCC 1 cut(s) 28
BspPI GGATC 1 cut(s) 265
BssECI CCNNGG 1 cut(s) 274
BssMI GATC 1 cut(s) 257
BssT1I CCWWGG 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 233
BstDEI CTNAG 2 cut(s) 54, 99
BstDSI CCRYGG 1 cut(s) 274
BstKTI GATC 1 cut(s) 260
BstMBI GATC 1 cut(s) 257
BstNI CCWGG 1 cut(s) 233
BstSCI CCNGG 1 cut(s) 231
Bsu36I CCTNAGG 1 cut(s) 99
BsuRI GGCC 1 cut(s) 144
BtgI CCRYGG 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 112
Cfr13I GGNCC 2 cut(s) 143, 235
CviAII CATG 2 cut(s) 275, 328
CviJI RGCY 6 cut(s) 14, 29, 127, 144, 223, 267
CviKI_1 RGCY 6 cut(s) 14, 29, 127, 144, 223, 267
DdeI CTNAG 2 cut(s) 54, 99
DpnI GATC 1 cut(s) 259
DpnII GATC 1 cut(s) 257
DrdI GACNNNNNNGTC 1 cut(s) 101
DseDI GACNNNNNNGTC 1 cut(s) 101
Ecl136II GAGCTC 1 cut(s) 267
Eco130I CCWWGG 1 cut(s) 274
Eco24I GRGCYC 1 cut(s) 269
Eco32I GATATC 1 cut(s) 283
Eco47I GGWCC 1 cut(s) 235
Eco53kI GAGCTC 1 cut(s) 267
Eco81I CCTNAGG 1 cut(s) 99
EcoICRI GAGCTC 1 cut(s) 267
EcoRII CCWGG 1 cut(s) 231
EcoRV GATATC 1 cut(s) 283
EcoT14I CCWWGG 1 cut(s) 274
EcoT38I GRGCYC 1 cut(s) 269
ErhI CCWWGG 1 cut(s) 274
FaeI CATG 2 cut(s) 278, 331
FaiI YATR 5 cut(s) 176, 194, 276, 297, 329
FalI AAGNNNNNCTT 2 cut(s) 207, 239
FatI CATG 2 cut(s) 274, 327
FriOI GRGCYC 1 cut(s) 269
FspBI CTAG 2 cut(s) 6, 239
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 2 cut(s) 278, 331
HincII GTYRAC 1 cut(s) 44
HindII GTYRAC 1 cut(s) 44
HindIII AAGCTT 1 cut(s) 221
HinfI GANTC 2 cut(s) 21, 359
Hpy166II GTNNAC 1 cut(s) 44
Hpy188I TCNGA 2 cut(s) 26, 167
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 44
HpyCH4IV ACGT 1 cut(s) 81
HpyCH4V TGCA 2 cut(s) 87, 209
HpyF3I CTNAG 2 cut(s) 54, 99
HpySE526I ACGT 1 cut(s) 81
Hsp92II CATG 2 cut(s) 278, 331
Kzo9I GATC 1 cut(s) 257
LmnI GCTCC 3 cut(s) 26, 124, 264
LpnPI CCDG 4 cut(s) 86, 159, 218, 245
MaeI CTAG 2 cut(s) 6, 239
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 245
MalI GATC 1 cut(s) 259
MboI GATC 1 cut(s) 257
MboII GAAGA 1 cut(s) 122
MhlI GDGCHC 1 cut(s) 269
MluCI AATT 3 cut(s) 113, 292, 334
MlyI GAGTC 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 4
MnlI CCTC 2 cut(s) 108, 190
MspA1I CMGCKG 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 233
MvaI CCWGG 1 cut(s) 233
NcoI CCATGG 1 cut(s) 274
NdeII GATC 1 cut(s) 257
NlaIII CATG 2 cut(s) 278, 331
NlaIV GGNNCC 1 cut(s) 28
NmuCI GTSAC 1 cut(s) 245
PfeI GAWTC 1 cut(s) 359
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
Psp124BI GAGCTC 1 cut(s) 269
Psp6I CCWGG 1 cut(s) 231
PspGI CCWGG 1 cut(s) 231
PspN4I GGNNCC 1 cut(s) 28
PspPI GGNCC 2 cut(s) 143, 235
SacI GAGCTC 1 cut(s) 269
Sau3AI GATC 1 cut(s) 257
Sau96I GGNCC 2 cut(s) 143, 235
SchI GAGTC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 233
SduI GDGCHC 1 cut(s) 269
SetI ASST 7 cut(s) 16, 84, 105, 129, 225, 252, 269
SinI GGWCC 1 cut(s) 235
Sse9I AATT 3 cut(s) 113, 292, 334
SsiI CCGC 1 cut(s) 51
SspMI CTAG 2 cut(s) 6, 239
SstI GAGCTC 1 cut(s) 269
StyD4I CCNGG 1 cut(s) 231
StyI CCWWGG 1 cut(s) 274
TaiI ACGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 93
TaqII GACCGA 1 cut(s) 29
TasI AATT 3 cut(s) 113, 292, 334
TfiI GAWTC 1 cut(s) 359
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 245
Tsp45I GTSAC 1 cut(s) 245
TspRI CASTG 1 cut(s) 112
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 1 cut(s) 334
XspI CTAG 2 cut(s) 6, 239
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.