Rh4AG166800

Splicing factor 3B subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
42058682 .. 42059387
706 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG166800.1

Sequence Viewer

Length: 195 bp
ATGACTCGAATTGCTCCGGGAGTCGGAGCGAACTTGCTCGTTAATATCTATGTTCCCAAAGATAGAATTACGAACCTTCATCAAGGACACAGATTCGTGAAGTTCCGAAGTGAAGATGATGCAATCAAGGTGCTTAATATGATCAAGCTTTATGGAAAGGCAATTTGTGTAAATGAGAATCTTCTAGTTGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

7.22

Weight (kDa)

9.65

Isoelectric Point (pI)

19.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 23
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
AsuC2I CCSGG 1 cut(s) 18
BclI TGATCA 1 cut(s) 141
BcnI CCSGG 1 cut(s) 18
BfaI CTAG 2 cut(s) 185, 193
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BmsI GCATC 1 cut(s) 109
BpuMI CCSGG 1 cut(s) 18
Bsc4I CCNNNNNNNGG 1 cut(s) 23
BseLI CCNNNNNNNGG 1 cut(s) 23
BsiSI CCGG 1 cut(s) 17
BslI CCNNNNNNNGG 1 cut(s) 23
Bsp143I GATC 1 cut(s) 141
BssMI GATC 1 cut(s) 141
BstKTI GATC 1 cut(s) 144
BstMBI GATC 1 cut(s) 141
BstSCI CCNGG 1 cut(s) 16
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
DpnI GATC 1 cut(s) 143
DpnII GATC 1 cut(s) 141
FaiI YATR 3 cut(s) 51, 140, 153
FbaI TGATCA 1 cut(s) 141
FspBI CTAG 2 cut(s) 185, 193
HapII CCGG 1 cut(s) 17
HindIII AAGCTT 1 cut(s) 146
HinfI GANTC 4 cut(s) 4, 21, 93, 178
HpaII CCGG 1 cut(s) 17
Hpy188I TCNGA 2 cut(s) 26, 107
Hpy188III TCNNGA 1 cut(s) 97
HpyAV CCTTC 1 cut(s) 86
HpyCH4V TGCA 1 cut(s) 122
Ksp22I TGATCA 1 cut(s) 141
Kzo9I GATC 1 cut(s) 141
LmnI GCTCC 2 cut(s) 19, 26
LpnPI CCDG 1 cut(s) 30
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 185, 193
MalI GATC 1 cut(s) 143
MboI GATC 1 cut(s) 141
MboII GAAGA 2 cut(s) 125, 173
MluCI AATT 3 cut(s) 9, 66, 162
MlyI GAGTC 1 cut(s) 30
MmeI TCCRAC 1 cut(s) 4
MseI TTAA 2 cut(s) 42, 135
MspI CCGG 1 cut(s) 17
MspR9I CCNGG 1 cut(s) 18
NciI CCSGG 1 cut(s) 18
NdeII GATC 1 cut(s) 141
PfeI GAWTC 2 cut(s) 93, 178
PfoI TCCNGGA 1 cut(s) 16
PleI GAGTC 1 cut(s) 29
PpsI GAGTC 1 cut(s) 29
SaqAI TTAA 2 cut(s) 42, 135
Sau3AI GATC 1 cut(s) 141
SchI GAGTC 1 cut(s) 30
ScrFI CCNGG 1 cut(s) 18
SetI ASST 3 cut(s) 78, 132, 150
SfaNI GCATC 1 cut(s) 109
SgeI CNNG 9 cut(s) 18, 29, 30, 46, 50, 95, 109, 139, 157
Sse9I AATT 3 cut(s) 9, 66, 162
SspMI CTAG 2 cut(s) 185, 193
StyD4I CCNGG 1 cut(s) 16
TaqI TCGA 1 cut(s) 7
TasI AATT 3 cut(s) 9, 66, 162
TfiI GAWTC 2 cut(s) 93, 178
Tru1I TTAA 2 cut(s) 42, 135
Tru9I TTAA 2 cut(s) 42, 135
TspDTI ATGAA 1 cut(s) 68
XspI CTAG 2 cut(s) 185, 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.