Rmu_ssc0000128.1_g000002

Splicing factor 3B subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000128.1
Physical Location & Seq
Reverse (-)
7677 .. 8380
704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000128.1_g000002.1.cds

Sequence Viewer

Length: 354 bp
atgatgactcgaattgctccgagagttagtgaagaattgttgtgggagctgtttgttcaaaccggtcctgttgttaatatctatgttcccaaagatagaattacgaaccttcatcaaggacacggattgttgaagttccgaagtgaagatgatgctgattacataggttttcattttctcaagttattgaatagctccctgattcctattaaagatgttgtttctgattgtaaatttgttgttttgactgctatgcaggcaatcaaggtgcttaatatgatcaagctttacggaaaggcaattcgtgtaaatgaggtatgtaattctgttttccctagcttcagaatcttctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.41

Weight (kDa)

9.0

Isoelectric Point (pI)

22.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 233
AcuI CTGAAG 1 cut(s) 325
AgeI ACCGGT 1 cut(s) 62
AgsI TTSAA 3 cut(s) 59, 133, 190
AluBI AGCT 4 cut(s) 49, 195, 286, 339
AluI AGCT 4 cut(s) 49, 195, 286, 339
ApoI RAATTY 1 cut(s) 233
AsiGI ACCGGT 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 65
AvaII GGWCC 1 cut(s) 65
BclI TGATCA 1 cut(s) 279
BfaI CTAG 2 cut(s) 336, 352
Bme18I GGWCC 1 cut(s) 65
BmgT120I GGNCC 1 cut(s) 65
BmsI GCATC 1 cut(s) 142
BpuEI CTTGAG 1 cut(s) 164
BsaWI WCCGGW 1 cut(s) 62
Bse118I RCCGGY 1 cut(s) 62
BshTI ACCGGT 1 cut(s) 62
BsiSI CCGG 1 cut(s) 63
Bsp143I GATC 1 cut(s) 279
BsrFI RCCGGY 1 cut(s) 62
BssAI RCCGGY 1 cut(s) 62
BssMI GATC 1 cut(s) 279
BstC8I GCNNGC 1 cut(s) 258
BstKTI GATC 1 cut(s) 282
BstMBI GATC 1 cut(s) 279
BstMWI GCNNNNNNNGC 1 cut(s) 257
Cac8I GCNNGC 1 cut(s) 258
Cfr10I RCCGGY 1 cut(s) 62
Cfr13I GGNCC 1 cut(s) 65
CspAI ACCGGT 1 cut(s) 62
CviJI RGCY 4 cut(s) 49, 195, 286, 339
CviKI_1 RGCY 4 cut(s) 49, 195, 286, 339
DpnI GATC 1 cut(s) 281
DpnII GATC 1 cut(s) 279
Eco47I GGWCC 1 cut(s) 65
Eco57I CTGAAG 1 cut(s) 325
FaiI YATR 5 cut(s) 84, 164, 254, 278, 319
FbaI TGATCA 1 cut(s) 279
FspBI CTAG 2 cut(s) 336, 352
HapII CCGG 1 cut(s) 63
HindIII AAGCTT 1 cut(s) 284
HinfI GANTC 3 cut(s) 7, 202, 345
HpaII CCGG 1 cut(s) 63
Hpy188I TCNGA 4 cut(s) 21, 140, 226, 344
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 257
Ksp22I TGATCA 1 cut(s) 279
Kzo9I GATC 1 cut(s) 279
LmnI GCTCC 3 cut(s) 22, 46, 200
LpnPI CCDG 4 cut(s) 76, 81, 212, 242
LweI GCATC 1 cut(s) 142
MaeI CTAG 2 cut(s) 336, 352
MalI GATC 1 cut(s) 281
MboI GATC 1 cut(s) 279
MboII GAAGA 3 cut(s) 44, 158, 340
MluCI AATT 6 cut(s) 12, 35, 99, 233, 300, 322
MnlI CCTC 1 cut(s) 307
MseI TTAA 3 cut(s) 75, 210, 273
MspI CCGG 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 257
NdeII GATC 1 cut(s) 279
PfeI GAWTC 2 cut(s) 202, 345
PinAI ACCGGT 1 cut(s) 62
PspPI GGNCC 1 cut(s) 65
SaqAI TTAA 3 cut(s) 75, 210, 273
Sau3AI GATC 1 cut(s) 279
Sau96I GGNCC 1 cut(s) 65
SetI ASST 8 cut(s) 51, 111, 169, 197, 270, 288, 318, 341
SfaNI GCATC 1 cut(s) 142
SinI GGWCC 1 cut(s) 65
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 6 cut(s) 12, 35, 99, 233, 300, 322
SspMI CTAG 2 cut(s) 336, 352
TaqI TCGA 1 cut(s) 10
TasI AATT 6 cut(s) 12, 35, 99, 233, 300, 322
TfiI GAWTC 2 cut(s) 202, 345
Tru1I TTAA 3 cut(s) 75, 210, 273
Tru9I TTAA 3 cut(s) 75, 210, 273
TspDTI ATGAA 2 cut(s) 101, 161
TspGWI ACGGA 2 cut(s) 138, 306
VpaK11BI GGWCC 1 cut(s) 65
XapI RAATTY 1 cut(s) 233
XspI CTAG 2 cut(s) 336, 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.