RchiOBHm_Chr1g0336321

ubiquitin-60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
28006404 .. 28006667
264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGCTCATTTTCATCAGAAAGCAACTCGAGGATGGTCATACTCCTGCTAATTACAACATTCAGAAAGAATCAACTCTGCATTTGGTTCTGAGGCTTCGTGGTGGTATTATCGAGCCTTCTCTCATGGCATTAACTAGAAAGTATAACCAAGAGAAGATGATCTGCCGCAAGTGTTATGCACTCCTTCATTGCGGTGTTGTCAACTATAGGAAGAAGTGTGGACACAACAACCAGCTAGTTGAGGTGAAGAAGAAGATCAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

10.18

Weight (kDa)

9.87

Isoelectric Point (pI)

43.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 2 - 33 1e-06 Ubiquitin family
Ribosomal_L40e PF01020 37 - 85 2.2e-20 Ribosomal L40e family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 166, 192
AluBI AGCT 1 cut(s) 235
AluI AGCT 1 cut(s) 235
Ama87I CYCGRG 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 256
AvaI CYCGRG 1 cut(s) 26
BccI CCATC 1 cut(s) 26
BfaI CTAG 2 cut(s) 135, 236
BfmI CTRYAG 1 cut(s) 205
BisI GCNGC 1 cut(s) 166
BlsI GCNGC 1 cut(s) 167
BmeT110I CYCGRG 1 cut(s) 26
Bse3DI GCAATG 1 cut(s) 187
BseGI GGATG 1 cut(s) 37
BseMI GCAATG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 80
BsiHKCI CYCGRG 1 cut(s) 26
BsoBI CYCGRG 1 cut(s) 26
Bsp143I GATC 2 cut(s) 159, 255
BspACI CCGC 2 cut(s) 166, 192
BspCNI CTCAG 1 cut(s) 81
BsrDI GCAATG 1 cut(s) 187
BssMI GATC 2 cut(s) 159, 255
BstDEI CTNAG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 2 cut(s) 162, 258
BstMBI GATC 2 cut(s) 159, 255
BstSFI CTRYAG 1 cut(s) 205
BtsCI GGATG 1 cut(s) 37
CviAII CATG 1 cut(s) 124
CviJI RGCY 3 cut(s) 94, 115, 235
CviKI_1 RGCY 3 cut(s) 94, 115, 235
DdeI CTNAG 1 cut(s) 89
DpnI GATC 2 cut(s) 161, 257
DpnII GATC 2 cut(s) 159, 255
Eco88I CYCGRG 1 cut(s) 26
FaeI CATG 1 cut(s) 127
FaiI YATR 5 cut(s) 39, 125, 144, 177, 207
FatI CATG 1 cut(s) 123
Fnu4HI GCNGC 1 cut(s) 166
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 166
FspBI CTAG 2 cut(s) 135, 236
GluI GCNGC 1 cut(s) 166
Hin1II CATG 1 cut(s) 127
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 68
HphI GGTGA 1 cut(s) 256
Hpy166II GTNNAC 2 cut(s) 202, 221
Hpy188I TCNGA 3 cut(s) 17, 63, 90
Hpy8I GTNNAC 2 cut(s) 202, 221
HpyAV CCTTC 2 cut(s) 126, 194
HpyCH4V TGCA 2 cut(s) 79, 179
HpyF3I CTNAG 1 cut(s) 89
Hsp92II CATG 1 cut(s) 127
Kzo9I GATC 2 cut(s) 159, 255
LpnPI CCDG 2 cut(s) 57, 245
MaeI CTAG 2 cut(s) 135, 236
MalI GATC 2 cut(s) 161, 257
MboI GATC 2 cut(s) 159, 255
MboII GAAGA 4 cut(s) 166, 223, 259, 262
MluCI AATT 1 cut(s) 49
MnlI CCTC 3 cut(s) 22, 84, 235
MseI TTAA 1 cut(s) 131
MslI CAYNNNNRTG 1 cut(s) 192
NdeII GATC 2 cut(s) 159, 255
NlaIII CATG 1 cut(s) 127
PaeR7I CTCGAG 1 cut(s) 26
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 167
PspXI VCTCGAGB 1 cut(s) 26
RseI CAYNNNNRTG 1 cut(s) 192
SaqAI TTAA 1 cut(s) 131
SatI GCNGC 1 cut(s) 166
Sau3AI GATC 2 cut(s) 159, 255
SetI ASST 2 cut(s) 237, 246
SfcI CTRYAG 1 cut(s) 205
Sfr274I CTCGAG 1 cut(s) 26
SlaI CTCGAG 1 cut(s) 26
SmiMI CAYNNNNRTG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
Sse9I AATT 1 cut(s) 49
SsiI CCGC 2 cut(s) 166, 192
SspMI CTAG 2 cut(s) 135, 236
TaqI TCGA 2 cut(s) 27, 111
TasI AATT 1 cut(s) 49
TauI GCSGC 1 cut(s) 168
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TspDTI ATGAA 1 cut(s) 176
XhoI CTCGAG 1 cut(s) 26
XspI CTAG 2 cut(s) 135, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.