RchiOBHm_Chr2g0148571

ubiquitin-60S ribosomal protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
66329600 .. 66329941
342 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51813

Sequence Viewer

Length: 342 bp
ATGCTCATTTTCATCAAAAAGCAGCTTAAGGATGGTCGTACTCCTGCTAATTACAACATTCAGAAAGAATCAACCCTGCATTTGGTTCTGAGGCTTCGTGATGGTATTATCGAGCCTTCTCTCATGGCATTGACTAGAAAGTATAACCAAGAGAAGATGATCTACCGCAAGTGTTATGCACTCCTTCATTGCGGTGTTGTCAACTGTAGGAAGAAGTGTGGACACAACAACCAGCTAGTTGAGGCGAAAGCAGAAGATCAAGTAGACATTGATTGCGTTGGGGGAATGCCATGTCTTTTTACATCATTGGCTTCTGCATTTGATCCCGTTCAATTAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

113

Amino Acids

12.84

Weight (kDa)

8.96

Isoelectric Point (pI)

41.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 2 - 33 1.4e-06 Ubiquitin family
Ribosomal_L40e PF01020 37 - 83 7.4e-19 Ribosomal L40e family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 264
AciI CCGC 2 cut(s) 166, 192
AclWI GGATC 1 cut(s) 317
AfaI GTAC 1 cut(s) 40
AfiI CCNNNNNNNGG 1 cut(s) 82
AflII CTTAAG 1 cut(s) 26
AgsI TTSAA 1 cut(s) 332
AluBI AGCT 2 cut(s) 25, 235
AluI AGCT 2 cut(s) 25, 235
AlwI GGATC 1 cut(s) 317
ApeKI GCWGC 1 cut(s) 22
BarI GAAGNNNNNNTAC 2 cut(s) 146, 178
BbvI GCAGC 1 cut(s) 34
BccI CCATC 2 cut(s) 26, 95
BfaI CTAG 2 cut(s) 135, 236
BfmI CTRYAG 1 cut(s) 205
BfrI CTTAAG 1 cut(s) 26
BisI GCNGC 1 cut(s) 23
BlsI GCNGC 1 cut(s) 24
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse3DI GCAATG 1 cut(s) 187
BseGI GGATG 1 cut(s) 37
BseLI CCNNNNNNNGG 1 cut(s) 82
BseMI GCAATG 1 cut(s) 187
BseMII CTCAG 1 cut(s) 80
BseXI GCAGC 1 cut(s) 34
BslI CCNNNNNNNGG 1 cut(s) 82
BsmI GAATGC 1 cut(s) 291
Bsp143I GATC 3 cut(s) 159, 256, 322
BspACI CCGC 2 cut(s) 166, 192
BspCNI CTCAG 1 cut(s) 81
BspPI GGATC 1 cut(s) 317
BspTI CTTAAG 1 cut(s) 26
BsrDI GCAATG 1 cut(s) 187
BssMI GATC 3 cut(s) 159, 256, 322
Bst4CI ACNGT 1 cut(s) 206
BstAFI CTTAAG 1 cut(s) 26
BstDEI CTNAG 1 cut(s) 89
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 3 cut(s) 162, 259, 325
BstMBI GATC 3 cut(s) 159, 256, 322
BstSFI CTRYAG 1 cut(s) 205
BstV1I GCAGC 1 cut(s) 34
BtsCI GGATG 1 cut(s) 37
Csp6I GTAC 1 cut(s) 39
CviAII CATG 2 cut(s) 124, 291
CviJI RGCY 5 cut(s) 25, 94, 115, 235, 311
CviKI_1 RGCY 5 cut(s) 25, 94, 115, 235, 311
CviQI GTAC 1 cut(s) 39
DdeI CTNAG 1 cut(s) 89
DpnI GATC 3 cut(s) 161, 258, 324
DpnII GATC 3 cut(s) 159, 256, 322
FaeI CATG 2 cut(s) 127, 294
FaiI YATR 4 cut(s) 125, 144, 177, 292
FatI CATG 2 cut(s) 123, 290
FblI GTMKAC 1 cut(s) 264
Fnu4HI GCNGC 1 cut(s) 23
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 23
FspBI CTAG 2 cut(s) 135, 236
GluI GCNGC 1 cut(s) 23
Hin1II CATG 2 cut(s) 127, 294
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HinfI GANTC 1 cut(s) 68
Hpy166II GTNNAC 3 cut(s) 202, 221, 265
Hpy188I TCNGA 2 cut(s) 63, 90
Hpy188III TCNNGA 1 cut(s) 98
Hpy8I GTNNAC 3 cut(s) 202, 221, 265
HpyAV CCTTC 2 cut(s) 126, 194
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4V TGCA 3 cut(s) 79, 179, 317
HpyF3I CTNAG 1 cut(s) 89
Hsp92II CATG 2 cut(s) 127, 294
Kzo9I GATC 3 cut(s) 159, 256, 322
LpnPI CCDG 3 cut(s) 57, 89, 245
Lsp1109I GCAGC 1 cut(s) 34
MaeI CTAG 2 cut(s) 135, 236
MalI GATC 3 cut(s) 161, 258, 324
MboI GATC 3 cut(s) 159, 256, 322
MboII GAAGA 3 cut(s) 166, 223, 266
MluCI AATT 2 cut(s) 49, 332
MnlI CCTC 2 cut(s) 84, 235
MseI TTAA 2 cut(s) 27, 335
MslI CAYNNNNRTG 1 cut(s) 192
MspCI CTTAAG 1 cut(s) 26
Mva1269I GAATGC 1 cut(s) 291
NdeII GATC 3 cut(s) 159, 256, 322
NlaIII CATG 2 cut(s) 127, 294
PctI GAATGC 1 cut(s) 291
PfeI GAWTC 1 cut(s) 68
PkrI GCNGC 1 cut(s) 24
RsaI GTAC 1 cut(s) 40
RsaNI GTAC 1 cut(s) 39
RseI CAYNNNNRTG 1 cut(s) 192
SaqAI TTAA 2 cut(s) 27, 335
SatI GCNGC 1 cut(s) 23
Sau3AI GATC 3 cut(s) 159, 256, 322
SetI ASST 2 cut(s) 27, 237
SfcI CTRYAG 1 cut(s) 205
SmiMI CAYNNNNRTG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
Sse9I AATT 2 cut(s) 49, 332
SsiI CCGC 2 cut(s) 166, 192
SspMI CTAG 2 cut(s) 135, 236
TaaI ACNGT 1 cut(s) 206
TaqI TCGA 1 cut(s) 111
TasI AATT 2 cut(s) 49, 332
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 2 cut(s) 27, 335
Tru9I TTAA 2 cut(s) 27, 335
TseI GCWGC 1 cut(s) 22
TspDTI ATGAA 1 cut(s) 176
Vha464I CTTAAG 1 cut(s) 26
XmiI GTMKAC 1 cut(s) 264
XspI CTAG 2 cut(s) 135, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.