RchiOBHm_Chr1g0345331

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
37715830 .. 37722506
6677 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 129 bp
ATGCAATTGTTGGCTGTGGCATGTTTGTCCCATGCAGCCAAAATGGAGGAGATTAATGTCCCAATCTCCCTTGATTTACAGGAATTGACTTCTTGGAATTTAAACCTTCAGAGTTTGCAGCAGCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

42

Amino Acids

4.72

Weight (kDa)

4.4

Isoelectric Point (pI)

98.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 97
AcuI CTGAAG 1 cut(s) 92
ApeKI GCWGC 3 cut(s) 35, 118, 121
ApoI RAATTY 1 cut(s) 97
AseI ATTAAT 1 cut(s) 54
BbvI GCAGC 1 cut(s) 47
BisI GCNGC 3 cut(s) 36, 119, 122
BlsI GCNGC 3 cut(s) 37, 120, 123
BseRI GAGGAG 1 cut(s) 62
BseXI GCAGC 1 cut(s) 47
BslFI GGGAC 2 cut(s) 13, 44
BsmFI GGGAC 2 cut(s) 13, 44
BstNSI RCATGY 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 47
CviAII CATG 2 cut(s) 21, 32
CviJI RGCY 2 cut(s) 14, 38
CviKI_1 RGCY 2 cut(s) 14, 38
DraI TTTAAA 1 cut(s) 102
Eco57I CTGAAG 1 cut(s) 92
FaeI CATG 2 cut(s) 24, 35
FaiI YATR 2 cut(s) 22, 33
FaqI GGGAC 2 cut(s) 13, 44
FatI CATG 2 cut(s) 20, 31
Fnu4HI GCNGC 3 cut(s) 36, 119, 122
Fsp4HI GCNGC 3 cut(s) 36, 119, 122
GluI GCNGC 3 cut(s) 36, 119, 122
Hin1II CATG 2 cut(s) 24, 35
Hpy188I TCNGA 1 cut(s) 111
HpyAV CCTTC 1 cut(s) 116
HpyCH4V TGCA 3 cut(s) 4, 35, 118
Hsp92II CATG 2 cut(s) 24, 35
LpnPI CCDG 1 cut(s) 65
Lsp1109I GCAGC 1 cut(s) 47
MfeI CAATTG 1 cut(s) 5
MluCI AATT 3 cut(s) 5, 83, 97
MnlI CCTC 1 cut(s) 40
MseI TTAA 2 cut(s) 54, 101
MunI CAATTG 1 cut(s) 5
NlaIII CATG 2 cut(s) 24, 35
NspI RCATGY 1 cut(s) 24
PkrI GCNGC 3 cut(s) 37, 120, 123
PshBI ATTAAT 1 cut(s) 54
SaqAI TTAA 2 cut(s) 54, 101
SatI GCNGC 3 cut(s) 36, 119, 122
SetI ASST 1 cut(s) 108
SgeI CNNG 5 cut(s) 33, 44, 83, 92, 105
Sse9I AATT 3 cut(s) 5, 83, 97
TasI AATT 3 cut(s) 5, 83, 97
Tru1I TTAA 2 cut(s) 54, 101
Tru9I TTAA 2 cut(s) 54, 101
TseI GCWGC 3 cut(s) 35, 118, 121
VspI ATTAAT 1 cut(s) 54
XapI RAATTY 1 cut(s) 97
XceI RCATGY 1 cut(s) 24
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.