RLG00000035747

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
71171080 .. 71175707
4628 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000035747

Sequence Viewer

Length: 363 bp
ATGCTGCCAGACAACGTACAGCTAGAGTTTTCACCACCGCTTCAAGCTATAGCTTCAGCATCAAGAAAATGGGAACTCACTTGCTTGCAAGAATTTGCCTCAATTTTGGAGCCCAACCTGTGCAAAATTGCAGCAATATCTCGCAACAATCAATTTGAAACATGTGCCGGTTTAGCTTGGATGAACTCAAGCATATTAGGCAAGTCATTGGATGTCTGGTCACATCAAAAACCCAAAAAGACACTTGATGAAATAAGCTATGACCTATTCCCACTAGTATTGTGTAAACAAGGAAGAAGTAATACATTGAATGTTGCTGCGGAAAATTGTCCGTGTAAATATTTTGGTTGCAATATTATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.39

Weight (kDa)

6.54

Isoelectric Point (pI)

48.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 38, 320
AcsI RAATTY 1 cut(s) 92
AcuI CTGAAG 1 cut(s) 39
AfaI GTAC 1 cut(s) 18
AflIII ACRYGT 1 cut(s) 161
AgsI TTSAA 3 cut(s) 44, 158, 310
AhlI ACTAGT 1 cut(s) 274
AluBI AGCT 5 cut(s) 22, 47, 53, 176, 258
AluI AGCT 5 cut(s) 22, 47, 53, 176, 258
ApeKI GCWGC 3 cut(s) 4, 131, 317
ApoI RAATTY 1 cut(s) 92
AsuHPI GGTGA 1 cut(s) 24
BanII GRGCYC 1 cut(s) 114
BarI GAAGNNNNNNTAC 2 cut(s) 286, 318
BbvI GCAGC 2 cut(s) 143, 304
BcuI ACTAGT 1 cut(s) 274
BfaI CTAG 3 cut(s) 23, 275, 361
BfmI CTRYAG 1 cut(s) 48
BisI GCNGC 3 cut(s) 5, 132, 318
BlsI GCNGC 3 cut(s) 6, 133, 319
BmiI GGNNCC 1 cut(s) 111
BmsI GCATC 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 172
Bse118I RCCGGY 1 cut(s) 167
BseGI GGATG 2 cut(s) 186, 217
BseXI GCAGC 2 cut(s) 143, 304
BsiSI CCGG 1 cut(s) 168
Bsp1286I GDGCHC 1 cut(s) 114
BspACI CCGC 2 cut(s) 38, 320
BspLI GGNNCC 1 cut(s) 111
BsrFI RCCGGY 1 cut(s) 167
BssAI RCCGGY 1 cut(s) 167
BstC8I GCNNGC 1 cut(s) 86
BstF5I GGATG 2 cut(s) 186, 217
BstMWI GCNNNNNNNGC 2 cut(s) 173, 198
BstNSI RCATGY 1 cut(s) 165
BstSFI CTRYAG 1 cut(s) 48
BstV1I GCAGC 2 cut(s) 143, 304
BtsCI GGATG 2 cut(s) 186, 217
Cac8I GCNNGC 1 cut(s) 86
Cfr10I RCCGGY 1 cut(s) 167
Csp6I GTAC 1 cut(s) 17
CspCI CAANNNNNGTGG 2 cut(s) 261, 296
CviAII CATG 1 cut(s) 162
CviJI RGCY 6 cut(s) 22, 47, 53, 112, 176, 258
CviKI_1 RGCY 6 cut(s) 22, 47, 53, 112, 176, 258
CviQI GTAC 1 cut(s) 17
Eco24I GRGCYC 1 cut(s) 114
Eco57I CTGAAG 1 cut(s) 39
EcoT38I GRGCYC 1 cut(s) 114
FaeI CATG 1 cut(s) 165
FaiI YATR 4 cut(s) 50, 163, 194, 261
FatI CATG 1 cut(s) 161
Fnu4HI GCNGC 3 cut(s) 5, 132, 318
FokI GGATG 2 cut(s) 193, 224
FriOI GRGCYC 1 cut(s) 114
Fsp4HI GCNGC 3 cut(s) 5, 132, 318
FspBI CTAG 3 cut(s) 23, 275, 361
GluI GCNGC 3 cut(s) 5, 132, 318
HapII CCGG 1 cut(s) 168
Hin1II CATG 1 cut(s) 165
HpaII CCGG 1 cut(s) 168
HphI GGTGA 1 cut(s) 24
Hpy166II GTNNAC 1 cut(s) 287
Hpy188III TCNNGA 1 cut(s) 63
Hpy8I GTNNAC 1 cut(s) 287
HpyCH4IV ACGT 1 cut(s) 15
HpyCH4V TGCA 4 cut(s) 88, 123, 131, 351
HpyF10VI GCNNNNNNNGC 2 cut(s) 173, 198
HpySE526I ACGT 1 cut(s) 15
Hsp92II CATG 1 cut(s) 165
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 4 cut(s) 21, 131, 181, 202
Lsp1109I GCAGC 2 cut(s) 143, 304
LweI GCATC 1 cut(s) 68
MaeI CTAG 3 cut(s) 23, 275, 361
MaeII ACGT 1 cut(s) 15
MaeIII GTNAC 1 cut(s) 219
MboII GAAGA 1 cut(s) 306
MhlI GDGCHC 1 cut(s) 114
MluCI AATT 5 cut(s) 92, 102, 126, 152, 325
MnlI CCTC 1 cut(s) 109
MspI CCGG 1 cut(s) 168
MwoI GCNNNNNNNGC 2 cut(s) 173, 198
NlaIII CATG 1 cut(s) 165
NlaIV GGNNCC 1 cut(s) 111
NmuCI GTSAC 1 cut(s) 219
NspI RCATGY 1 cut(s) 165
PciI ACATGT 1 cut(s) 161
PkrI GCNGC 3 cut(s) 6, 133, 319
PscI ACATGT 1 cut(s) 161
PspN4I GGNNCC 1 cut(s) 111
RsaI GTAC 1 cut(s) 18
RsaNI GTAC 1 cut(s) 17
SatI GCNGC 3 cut(s) 5, 132, 318
SduI GDGCHC 1 cut(s) 114
SetI ASST 8 cut(s) 18, 24, 49, 55, 120, 178, 260, 267
SfaNI GCATC 1 cut(s) 68
SfcI CTRYAG 1 cut(s) 48
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
SpeI ACTAGT 1 cut(s) 274
Sse9I AATT 5 cut(s) 92, 102, 126, 152, 325
SsiI CCGC 2 cut(s) 38, 320
SspI AATATT 2 cut(s) 341, 355
SspMI CTAG 3 cut(s) 23, 275, 361
TaiI ACGT 1 cut(s) 18
TasI AATT 5 cut(s) 92, 102, 126, 152, 325
TseFI GTSAC 1 cut(s) 219
TseI GCWGC 3 cut(s) 4, 131, 317
Tsp45I GTSAC 1 cut(s) 219
TspDTI ATGAA 2 cut(s) 197, 264
TspGWI ACGGA 1 cut(s) 321
XapI RAATTY 1 cut(s) 92
XceI RCATGY 1 cut(s) 165
XspI CTAG 3 cut(s) 23, 275, 361
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.