Rh5AG310000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
44505828 .. 44506127
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG310000.1

Sequence Viewer

Length: 216 bp
ATGGTTTTGGGACGTCGATTATGCTCTCCTAGCCACACCGGAAAGGCCCAACAAGCCAACCAAAGTTGCTCTTCCGATTTGGCCGTAAATGATGAAAACCAGGCTCCACTTCCGGCAACCATTTACTACATTTCCTCTGAGAATCTCAAAGATTCCAAGATTCAGGACTGGATTCAAAGGATTGGACTCAAGTGTGCGATTCTCTTAACACGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.86

Weight (kDa)

8.57

Isoelectric Point (pI)

57.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 16
AcoI YGGCCR 1 cut(s) 81
AcyI GRCGYC 1 cut(s) 13
AgsI TTSAA 1 cut(s) 176
AjnI CCWGG 1 cut(s) 99
AoxI GGCC 2 cut(s) 45, 81
AspS9I GGNCC 1 cut(s) 46
BceAI ACGGC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 101
BfaI CTAG 2 cut(s) 30, 214
Bme1390I CCNGG 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 46
BmiI GGNNCC 1 cut(s) 105
BmrFI CCNGG 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 173
BsaHI GRCGYC 1 cut(s) 13
BsaWI WCCGGW 1 cut(s) 38
Bse1I ACTGG 1 cut(s) 173
BseBI CCWGG 1 cut(s) 101
BseMII CTCAG 1 cut(s) 129
BseNI ACTGG 1 cut(s) 173
BshFI GGCC 2 cut(s) 47, 83
BsiSI CCGG 2 cut(s) 39, 113
BslFI GGGAC 1 cut(s) 24
BsmFI GGGAC 1 cut(s) 24
BsnI GGCC 2 cut(s) 47, 83
BspANI GGCC 2 cut(s) 47, 83
BspCNI CTCAG 1 cut(s) 130
BspLI GGNNCC 1 cut(s) 105
BspQI GCTCTTC 1 cut(s) 76
BsrI ACTGG 1 cut(s) 173
BssNI GRCGYC 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 101
Bst6I CTCTTC 1 cut(s) 76
BstACI GRCGYC 1 cut(s) 13
BstDEI CTNAG 1 cut(s) 138
BstMWI GCNNNNNNNGC 2 cut(s) 30, 53
BstNI CCWGG 1 cut(s) 101
BstSCI CCNGG 1 cut(s) 99
BsuRI GGCC 2 cut(s) 47, 83
Cfr13I GGNCC 1 cut(s) 46
CviJI RGCY 5 cut(s) 33, 47, 56, 83, 104
CviKI_1 RGCY 5 cut(s) 33, 47, 56, 83, 104
DdeI CTNAG 1 cut(s) 138
EaeI YGGCCR 1 cut(s) 81
Eam1104I CTCTTC 1 cut(s) 76
EarI CTCTTC 1 cut(s) 76
EcoRII CCWGG 1 cut(s) 99
FaiI YATR 1 cut(s) 22
FalI AAGNNNNNCTT 2 cut(s) 55, 87
FaqI GGGAC 1 cut(s) 24
FspBI CTAG 2 cut(s) 30, 214
HaeIII GGCC 2 cut(s) 47, 83
HapII CCGG 2 cut(s) 39, 113
Hin1I GRCGYC 1 cut(s) 13
HinfI GANTC 6 cut(s) 142, 152, 160, 172, 186, 199
HpaII CCGG 2 cut(s) 39, 113
Hpy188I TCNGA 2 cut(s) 76, 139
Hpy188III TCNNGA 1 cut(s) 164
Hpy99I CGWCG 1 cut(s) 18
HpyCH4IV ACGT 1 cut(s) 13
HpyF10VI GCNNNNNNNGC 2 cut(s) 30, 53
HpyF3I CTNAG 1 cut(s) 138
HpySE526I ACGT 1 cut(s) 13
Hsp92I GRCGYC 1 cut(s) 13
LguI GCTCTTC 1 cut(s) 76
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 6 cut(s) 52, 86, 113, 126, 149, 154
MaeI CTAG 2 cut(s) 30, 214
MaeII ACGT 1 cut(s) 13
MboII GAAGA 1 cut(s) 63
MlyI GAGTC 1 cut(s) 180
MnlI CCTC 1 cut(s) 145
MseI TTAA 1 cut(s) 206
MspI CCGG 2 cut(s) 39, 113
MspR9I CCNGG 1 cut(s) 101
MvaI CCWGG 1 cut(s) 101
MwoI GCNNNNNNNGC 2 cut(s) 30, 53
NlaIV GGNNCC 1 cut(s) 105
PciSI GCTCTTC 1 cut(s) 76
PfeI GAWTC 5 cut(s) 142, 152, 160, 172, 199
PleI GAGTC 1 cut(s) 180
PpsI GAGTC 1 cut(s) 180
Psp6I CCWGG 1 cut(s) 99
PspGI CCWGG 1 cut(s) 99
PspN4I GGNNCC 1 cut(s) 105
PspPI GGNCC 1 cut(s) 46
SapI GCTCTTC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 46
SchI GAGTC 1 cut(s) 180
ScrFI CCNGG 1 cut(s) 101
SetI ASST 1 cut(s) 16
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
SspMI CTAG 2 cut(s) 30, 214
StyD4I CCNGG 1 cut(s) 99
TaiI ACGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 16
TfiI GAWTC 5 cut(s) 142, 152, 160, 172, 199
Tru1I TTAA 1 cut(s) 206
Tru9I TTAA 1 cut(s) 206
TspDTI ATGAA 1 cut(s) 108
XspI CTAG 2 cut(s) 30, 214
ZraI GACGTC 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.