Rroxscaffold_1G00034780

Belongs to the cyclin family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
OG0010611
Physical Location & Seq
Reverse (-)
50521645 .. 50523934
2290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00034780.1

Sequence Viewer

Length: 276 bp
ATGAGCCAAATATCCCAGGCAAATGCCCATTTCAGCTTCGGACCTCTGTGTCAATATCTATCTGTAAGCTTCTTGGATCGCTGTCTTTCAGCCTATGAAATACCTAATGGCAAAGCTTGGATTATGCAATTGTTGGCTGTGGCATGTTTGCCCCTTGCGGCCAAAATAAAGGAGATTAATGTCCCACTCTACCTTGATTTACAGGTCAGGCTTTGGTCTCATTTTAATTTGATCTTTCTTAAACTTTCTGATTTGTTTCGGTTCCGAAAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cyclin_C Cyclin_N

Protein Analysis

91

Amino Acids

10.49

Weight (kDa)

9.22

Isoelectric Point (pI)

26.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyclin_N PF00134 4 - 69 1.1e-11 Cyclin, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 48
AciI CCGC 1 cut(s) 158
AclWI GGATC 1 cut(s) 84
AcoI YGGCCR 1 cut(s) 159
AjnI CCWGG 1 cut(s) 15
AluBI AGCT 3 cut(s) 36, 69, 116
AluI AGCT 3 cut(s) 36, 69, 116
Alw26I GTCTC 1 cut(s) 222
AlwI GGATC 1 cut(s) 84
AoxI GGCC 1 cut(s) 159
AseI ATTAAT 1 cut(s) 177
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 17
BcoDI GTCTC 1 cut(s) 222
BisI GCNGC 1 cut(s) 159
BlsI GCNGC 1 cut(s) 160
Bme1390I CCNGG 1 cut(s) 17
Bme18I GGWCC 1 cut(s) 41
BmgT120I GGNCC 1 cut(s) 41
BmiI GGNNCC 1 cut(s) 263
BmrFI CCNGG 1 cut(s) 17
BsaI GGTCTC 1 cut(s) 222
BsaJI CCNNGG 1 cut(s) 15
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 15
BshFI GGCC 1 cut(s) 161
BslFI GGGAC 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 222
BsmFI GGGAC 1 cut(s) 167
BsnI GGCC 1 cut(s) 161
Bso31I GGTCTC 1 cut(s) 222
Bsp143I GATC 2 cut(s) 76, 231
BspACI CCGC 1 cut(s) 158
BspANI GGCC 1 cut(s) 161
BspLI GGNNCC 1 cut(s) 263
BspPI GGATC 1 cut(s) 84
BspTNI GGTCTC 1 cut(s) 222
BssECI CCNNGG 1 cut(s) 15
BssMI GATC 2 cut(s) 76, 231
Bst2UI CCWGG 1 cut(s) 17
BstKTI GATC 2 cut(s) 79, 234
BstMAI GTCTC 1 cut(s) 222
BstMBI GATC 2 cut(s) 76, 231
BstNI CCWGG 1 cut(s) 17
BstNSI RCATGY 1 cut(s) 147
BstSCI CCNGG 1 cut(s) 15
BsuRI GGCC 1 cut(s) 161
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 1 cut(s) 144
CviJI RGCY 8 cut(s) 6, 36, 69, 92, 116, 137, 161, 211
CviKI_1 RGCY 8 cut(s) 6, 36, 69, 92, 116, 137, 161, 211
DpnI GATC 2 cut(s) 78, 233
DpnII GATC 2 cut(s) 76, 231
DrdI GACNNNNNNGTC 1 cut(s) 48
DseDI GACNNNNNNGTC 1 cut(s) 48
EaeI YGGCCR 1 cut(s) 159
Eco31I GGTCTC 1 cut(s) 222
Eco47I GGWCC 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 15
FaeI CATG 1 cut(s) 147
FaiI YATR 3 cut(s) 96, 125, 145
FaqI GGGAC 1 cut(s) 167
FatI CATG 1 cut(s) 143
Fnu4HI GCNGC 1 cut(s) 159
Fsp4HI GCNGC 1 cut(s) 159
GluI GCNGC 1 cut(s) 159
HaeIII GGCC 1 cut(s) 161
Hin1II CATG 1 cut(s) 147
HindIII AAGCTT 2 cut(s) 67, 114
Hpy188I TCNGA 3 cut(s) 41, 250, 266
HpyCH4V TGCA 1 cut(s) 127
Hsp92II CATG 1 cut(s) 147
Kzo9I GATC 2 cut(s) 76, 231
LpnPI CCDG 4 cut(s) 2, 29, 188, 193
MalI GATC 2 cut(s) 78, 233
MboI GATC 2 cut(s) 76, 231
MfeI CAATTG 1 cut(s) 128
MluCI AATT 2 cut(s) 128, 226
MnlI CCTC 1 cut(s) 54
MseI TTAA 3 cut(s) 177, 225, 240
MspR9I CCNGG 1 cut(s) 17
MunI CAATTG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 17
NdeII GATC 2 cut(s) 76, 231
NlaIII CATG 1 cut(s) 147
NlaIV GGNNCC 1 cut(s) 263
NspI RCATGY 1 cut(s) 147
PkrI GCNGC 1 cut(s) 160
PshBI ATTAAT 1 cut(s) 177
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
PspN4I GGNNCC 1 cut(s) 263
PspPI GGNCC 1 cut(s) 41
SaqAI TTAA 3 cut(s) 177, 225, 240
SatI GCNGC 1 cut(s) 159
Sau3AI GATC 2 cut(s) 76, 231
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 17
SetI ASST 7 cut(s) 38, 46, 71, 106, 118, 195, 207
SgeI CNNG 9 cut(s) 28, 29, 85, 129, 156, 167, 206, 215, 220
SinI GGWCC 1 cut(s) 41
Sse9I AATT 2 cut(s) 128, 226
SsiI CCGC 1 cut(s) 158
StyD4I CCNGG 1 cut(s) 15
TasI AATT 2 cut(s) 128, 226
TauI GCSGC 1 cut(s) 161
Tru1I TTAA 3 cut(s) 177, 225, 240
Tru9I TTAA 3 cut(s) 177, 225, 240
TspDTI ATGAA 1 cut(s) 111
VpaK11BI GGWCC 1 cut(s) 41
VspI ATTAAT 1 cut(s) 177
XceI RCATGY 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.