RchiOBHm_Chr1g0320321

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
7984384 .. 7985840
1457 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55048

Sequence Viewer

Length: 123 bp
ATGGTGGTGTCTTTGGATGAAAGACACGTCGGGGGGAGGATTCAAGGAAGCATATCAAGTGTGCAGCTGAGATTCTTTGCCACCAACTTTTCAAGGGAAAAAAATTTGAAGACGGAGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

40

Amino Acids

4.55

Weight (kDa)

8.36

Isoelectric Point (pI)

29.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 103
AflIII ACRYGT 1 cut(s) 25
AgsI TTSAA 3 cut(s) 44, 93, 109
AjiI CACGTC 1 cut(s) 28
AluBI AGCT 1 cut(s) 67
AluI AGCT 1 cut(s) 67
ApeKI GCWGC 1 cut(s) 64
ApoI RAATTY 1 cut(s) 103
BbsI GAAGAC 1 cut(s) 116
BbvI GCAGC 1 cut(s) 76
BfaI CTAG 1 cut(s) 121
BisI GCNGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 66
BmgBI CACGTC 1 cut(s) 28
BpiI GAAGAC 1 cut(s) 116
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 59
BseXI GCAGC 1 cut(s) 76
BsgI GTGCAG 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 60
BstDEI CTNAG 1 cut(s) 68
BstF5I GGATG 1 cut(s) 22
BstV1I GCAGC 1 cut(s) 76
BstV2I GAAGAC 1 cut(s) 116
BtrI CACGTC 1 cut(s) 28
BtsCI GGATG 1 cut(s) 22
CviJI RGCY 1 cut(s) 67
CviKI_1 RGCY 1 cut(s) 67
DdeI CTNAG 1 cut(s) 68
FaiI YATR 1 cut(s) 53
Fnu4HI GCNGC 1 cut(s) 65
FokI GGATG 1 cut(s) 29
Fsp4HI GCNGC 1 cut(s) 65
FspBI CTAG 1 cut(s) 121
GluI GCNGC 1 cut(s) 65
HinfI GANTC 2 cut(s) 40, 72
Hpy99I CGWCG 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 64
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 1 cut(s) 27
Lsp1109I GCAGC 1 cut(s) 76
MaeI CTAG 1 cut(s) 121
MaeII ACGT 1 cut(s) 27
MboII GAAGA 1 cut(s) 121
MluCI AATT 1 cut(s) 103
MnlI CCTC 2 cut(s) 30, 109
MspA1I CMGCKG 1 cut(s) 67
PfeI GAWTC 2 cut(s) 40, 72
PkrI GCNGC 1 cut(s) 66
PvuII CAGCTG 1 cut(s) 67
SatI GCNGC 1 cut(s) 65
SetI ASST 2 cut(s) 30, 69
SgeI CNNG 5 cut(s) 38, 43, 56, 69, 105
Sse9I AATT 1 cut(s) 103
SspMI CTAG 1 cut(s) 121
TaiI ACGT 1 cut(s) 30
TasI AATT 1 cut(s) 103
TfiI GAWTC 2 cut(s) 40, 72
TseI GCWGC 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 33
XapI RAATTY 1 cut(s) 103
XspI CTAG 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.