Rh6AG071100

Belongs to the 14-3-3 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
10128324 .. 10129377
1054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG071100.1

Sequence Viewer

Length: 207 bp
ATGGTAGCAAGTTACAACAAGGGCTTTGAGGAAGCAATTGCTGAAGTTGATACGCTGGGAGAGAAATCATACAAGGACAGCACTCTAATCATGCAACTTCTGAGGGACAACCTCACTGTTTGGACTACAGATTTGCAGATTAAACCTGTCAATCTCATTGAGATCTCAAAATCAGACCTATGTTATGATATACAATTTGATCCTTAA

Protein Analysis

68

Amino Acids

7.77

Weight (kDa)

4.24

Isoelectric Point (pI)

32.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
14-3-3 PF00244 6 - 42 1.9e-12 14-3-3 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 194
AcuI CTGAAG 1 cut(s) 63
AlwI GGATC 1 cut(s) 194
ArsI GACNNNNNNTTYG 2 cut(s) 115, 147
BfmI CTRYAG 1 cut(s) 126
BglII AGATCT 1 cut(s) 162
BseMII CTCAG 1 cut(s) 92
BseYI CCCAGC 1 cut(s) 55
BslFI GGGAC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 119
Bsp143I GATC 2 cut(s) 162, 199
BspCNI CTCAG 1 cut(s) 93
BspPI GGATC 1 cut(s) 194
BssMI GATC 2 cut(s) 162, 199
Bst4CI ACNGT 1 cut(s) 118
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 2 cut(s) 165, 202
BstMBI GATC 2 cut(s) 162, 199
BstSFI CTRYAG 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 162
BstYI RGATCY 1 cut(s) 162
BtsIMutI CAGTG 1 cut(s) 114
CviAII CATG 1 cut(s) 91
CviJI RGCY 1 cut(s) 24
CviKI_1 RGCY 1 cut(s) 24
DdeI CTNAG 1 cut(s) 101
DpnI GATC 2 cut(s) 164, 201
DpnII GATC 2 cut(s) 162, 199
Eco57I CTGAAG 1 cut(s) 63
FaeI CATG 1 cut(s) 94
FaiI YATR 5 cut(s) 70, 92, 181, 186, 191
FaqI GGGAC 1 cut(s) 119
FatI CATG 1 cut(s) 90
GsaI CCCAGC 1 cut(s) 59
Hin1II CATG 1 cut(s) 94
Hpy188I TCNGA 2 cut(s) 102, 175
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 94, 136
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 1 cut(s) 94
Kzo9I GATC 2 cut(s) 162, 199
LpnPI CCDG 2 cut(s) 41, 159
MaeIII GTNAC 1 cut(s) 11
MalI GATC 2 cut(s) 164, 201
MboI GATC 2 cut(s) 162, 199
MfeI CAATTG 1 cut(s) 36
MflI RGATCY 1 cut(s) 162
MluCI AATT 2 cut(s) 36, 194
MnlI CCTC 3 cut(s) 22, 96, 122
MseI TTAA 2 cut(s) 141, 205
MunI CAATTG 1 cut(s) 36
NdeII GATC 2 cut(s) 162, 199
NlaIII CATG 1 cut(s) 94
PspFI CCCAGC 1 cut(s) 55
PsuI RGATCY 1 cut(s) 162
SaqAI TTAA 2 cut(s) 141, 205
Sau3AI GATC 2 cut(s) 162, 199
SetI ASST 3 cut(s) 114, 148, 180
SfcI CTRYAG 1 cut(s) 126
SgeI CNNG 6 cut(s) 21, 31, 68, 85, 103, 158
Sse9I AATT 2 cut(s) 36, 194
TaaI ACNGT 1 cut(s) 118
TasI AATT 2 cut(s) 36, 194
Tru1I TTAA 2 cut(s) 141, 205
Tru9I TTAA 2 cut(s) 141, 205
TscAI CASTG 1 cut(s) 121
TspRI CASTG 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.