Rroxscaffold_7G00210630

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
Physical Location & Seq
Forward (+)
61126426 .. 61135295
8870 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00210630.1

Sequence Viewer

Length: 225 bp
ATGAATATCATCAAACTTTTGTTCATCTCTCTGTTCCTGGAGAAAGATGAACAAAAGTTTGATGATTGTCAGAGTCTTGATCTGTTTGGATTTGGATTTCCCAGATCATTATCTATGGATAGGATTCAGGAAAAATCACTGTTCCGTTCGAAGCACTTGTCCTGCTCTGTTCCTTCACATGGTTCATATCGATGGTGGTGGTTTAAAGAAACATACAACGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.9

Weight (kDa)

7.8

Isoelectric Point (pI)

49.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 179
AjnI CCWGG 1 cut(s) 36
ArsI GACNNNNNNTTYG 2 cut(s) 143, 175
AsuII TTCGAA 1 cut(s) 149
BccI CCATC 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 59
Bpu14I TTCGAA 1 cut(s) 149
Bsa29I ATCGAT 1 cut(s) 190
BsaBI GATNNNNATC 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 179
Bse8I GATNNNNATC 1 cut(s) 109
BseBI CCWGG 1 cut(s) 38
BseCI ATCGAT 1 cut(s) 190
BseJI GATNNNNATC 1 cut(s) 109
BseLI CCNNNNNNNGG 1 cut(s) 179
BshVI ATCGAT 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 179
Bsp119I TTCGAA 1 cut(s) 149
Bsp143I GATC 2 cut(s) 79, 104
BspDI ATCGAT 1 cut(s) 190
BspT104I TTCGAA 1 cut(s) 149
BssMI GATC 2 cut(s) 79, 104
Bst2UI CCWGG 1 cut(s) 38
Bst4CI ACNGT 1 cut(s) 141
BstBI TTCGAA 1 cut(s) 149
BstKTI GATC 2 cut(s) 82, 107
BstMBI GATC 2 cut(s) 79, 104
BstNI CCWGG 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 36
Bsu15I ATCGAT 1 cut(s) 190
BsuTUI ATCGAT 1 cut(s) 190
BtsIMutI CAGTG 1 cut(s) 137
ClaI ATCGAT 1 cut(s) 190
CviAII CATG 1 cut(s) 179
DpnI GATC 2 cut(s) 81, 106
DpnII GATC 2 cut(s) 79, 104
DraI TTTAAA 1 cut(s) 205
EcoRII CCWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 182
FaiI YATR 4 cut(s) 116, 180, 187, 214
FatI CATG 1 cut(s) 178
GsuI CTGGAG 1 cut(s) 59
Hin1II CATG 1 cut(s) 182
HinfI GANTC 2 cut(s) 73, 124
Hpy188I TCNGA 1 cut(s) 72
Hpy188III TCNNGA 2 cut(s) 77, 128
HpyAV CCTTC 1 cut(s) 183
HpyCH4III ACNGT 1 cut(s) 141
Hsp92II CATG 1 cut(s) 182
Kzo9I GATC 2 cut(s) 79, 104
LpnPI CCDG 5 cut(s) 23, 50, 113, 115, 175
MalI GATC 2 cut(s) 81, 106
MboI GATC 2 cut(s) 79, 104
MlyI GAGTC 1 cut(s) 82
MseI TTAA 2 cut(s) 204, 223
MslI CAYNNNNRTG 1 cut(s) 190
MspR9I CCNGG 1 cut(s) 38
MvaI CCWGG 1 cut(s) 38
NdeII GATC 2 cut(s) 79, 104
NlaIII CATG 1 cut(s) 182
NspV TTCGAA 1 cut(s) 149
PfeI GAWTC 1 cut(s) 124
PfoI TCCNGGA 1 cut(s) 36
PleI GAGTC 1 cut(s) 81
PpsI GAGTC 1 cut(s) 81
Psp6I CCWGG 1 cut(s) 36
PspGI CCWGG 1 cut(s) 36
RseI CAYNNNNRTG 1 cut(s) 190
SaqAI TTAA 2 cut(s) 204, 223
Sau3AI GATC 2 cut(s) 79, 104
SchI GAGTC 1 cut(s) 82
ScrFI CCNGG 1 cut(s) 38
SfuI TTCGAA 1 cut(s) 149
SgeI CNNG 8 cut(s) 49, 50, 89, 114, 140, 169, 174, 191
SmiMI CAYNNNNRTG 1 cut(s) 190
StyD4I CCNGG 1 cut(s) 36
TaaI ACNGT 1 cut(s) 141
TaqI TCGA 2 cut(s) 149, 190
TfiI GAWTC 1 cut(s) 124
Tru1I TTAA 2 cut(s) 204, 223
Tru9I TTAA 2 cut(s) 204, 223
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 4 cut(s) 13, 17, 63, 174
TspGWI ACGGA 1 cut(s) 134
TspRI CASTG 1 cut(s) 144
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.