Rh6AG110900

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
16193740 .. 16208023
14284 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG110900.1

Sequence Viewer

Length: 174 bp
ATGACAAGGAGAATGAGCAGATTGTTACGGCATGGTTGTGCTGAAAATTACAGAATTGGAGAAACAATTGAGCAAGGAAGAATTGAATCTAATCCAAAGTTTGATCCTTTTTCAATGTCGATTCGTTTGGTTGATATAGGTGAAAAAATTTATTTGCGTCTGGTGCTTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

57

Amino Acids

6.74

Weight (kDa)

9.1

Isoelectric Point (pI)

63.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 98
AcsI RAATTY 1 cut(s) 147
AgsI TTSAA 3 cut(s) 86, 114, 170
AlwI GGATC 1 cut(s) 98
ApoI RAATTY 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 152
BceAI ACGGC 1 cut(s) 44
Bsp143I GATC 1 cut(s) 103
BspPI GGATC 1 cut(s) 98
BssMI GATC 1 cut(s) 103
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 163
CseI GACGC 1 cut(s) 146
CviAII CATG 1 cut(s) 32
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
FaeI CATG 1 cut(s) 35
FaiI YATR 2 cut(s) 33, 137
FatI CATG 1 cut(s) 31
FspEI CC 9 cut(s) 13, 18, 42, 60, 108, 113, 120, 123, 146
HgaI GACGC 1 cut(s) 146
Hin1II CATG 1 cut(s) 35
HinfI GANTC 2 cut(s) 86, 121
HphI GGTGA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
Hsp92II CATG 1 cut(s) 35
Kzo9I GATC 1 cut(s) 103
LpnPI CCDG 1 cut(s) 146
MaeIII GTNAC 1 cut(s) 24
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 90
MfeI CAATTG 1 cut(s) 66
MluCI AATT 5 cut(s) 46, 54, 66, 81, 147
MslI CAYNNNNRTG 1 cut(s) 36
MunI CAATTG 1 cut(s) 66
MwoI GCNNNNNNNGC 1 cut(s) 163
NdeII GATC 1 cut(s) 103
NlaIII CATG 1 cut(s) 35
PfeI GAWTC 2 cut(s) 86, 121
RseI CAYNNNNRTG 1 cut(s) 36
Sau3AI GATC 1 cut(s) 103
SetI ASST 1 cut(s) 142
SgeI CNNG 3 cut(s) 18, 44, 86
SmiMI CAYNNNNRTG 1 cut(s) 36
Sse9I AATT 5 cut(s) 46, 54, 66, 81, 147
TaqI TCGA 1 cut(s) 119
TasI AATT 5 cut(s) 46, 54, 66, 81, 147
TfiI GAWTC 2 cut(s) 86, 121
XapI RAATTY 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.