Rh6AG070600

Belongs to the 14-3-3 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0009729
Physical Location & Seq
Reverse (-)
10095432 .. 10098215
2784 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG070600.1

Sequence Viewer

Length: 267 bp
ATGGTAGCAAGTTACAACAAGGGCTTTGAGGAAGCAATTGCTGAAGTTGATACGCTGGGAGAGAAATCATACAAGGACAGCACTCTAATCATGCAACTTCTGAGGGACAACCTCACTGTTTGGACTACAGATTTGCAGAAACATACTAATTTCTTTGTGGGAATGGATGCTGTTAACATTGAGAACTGGAGGATAACTAAGTTGTGGTACACTTCCTCAATGCAATTATTTTTTGAGGAGTTACTTAAGGCGAAATCACTTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04011 ko04110 ko04114 ko04151 ko04390 ko04391 ko04722 ko05169 ko05203 map04011 map04110 map04114 map04151 map04390 map04391 map04722 map05169 map05203
Pfam Domains
Protein Families
14-3-3

Protein Analysis

88

Amino Acids

10.27

Weight (kDa)

4.99

Isoelectric Point (pI)

24.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
14-3-3 PF00244 6 - 42 3.6e-12 14-3-3 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 63
AfaI GTAC 1 cut(s) 209
AflII CTTAAG 1 cut(s) 245
ArsI GACNNNNNNTTYG 2 cut(s) 115, 147
BfmI CTRYAG 1 cut(s) 126
BfrI CTTAAG 1 cut(s) 245
BmsI GCATC 1 cut(s) 157
BpmI CTGGAG 1 cut(s) 208
Bse1I ACTGG 1 cut(s) 191
BseGI GGATG 1 cut(s) 172
BseMII CTCAG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 191
BseRI GAGGAG 1 cut(s) 251
BseYI CCCAGC 1 cut(s) 55
BslFI GGGAC 1 cut(s) 119
BsmFI GGGAC 1 cut(s) 119
BspCNI CTCAG 1 cut(s) 93
BspTI CTTAAG 1 cut(s) 245
BsrI ACTGG 1 cut(s) 191
Bst4CI ACNGT 1 cut(s) 118
BstAFI CTTAAG 1 cut(s) 245
BstDEI CTNAG 2 cut(s) 101, 198
BstF5I GGATG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 126
BtsCI GGATG 1 cut(s) 172
BtsIMutI CAGTG 1 cut(s) 114
Csp6I GTAC 1 cut(s) 208
CviAII CATG 1 cut(s) 91
CviJI RGCY 1 cut(s) 24
CviKI_1 RGCY 1 cut(s) 24
CviQI GTAC 1 cut(s) 208
DdeI CTNAG 2 cut(s) 101, 198
Eco57I CTGAAG 1 cut(s) 63
FaeI CATG 1 cut(s) 94
FaiI YATR 3 cut(s) 70, 92, 144
FaqI GGGAC 1 cut(s) 119
FatI CATG 1 cut(s) 90
FokI GGATG 1 cut(s) 179
GsaI CCCAGC 1 cut(s) 59
GsuI CTGGAG 1 cut(s) 208
Hin1II CATG 1 cut(s) 94
HincII GTYRAC 1 cut(s) 175
HindII GTYRAC 1 cut(s) 175
HpaI GTTAAC 1 cut(s) 175
Hpy166II GTNNAC 2 cut(s) 175, 210
Hpy188I TCNGA 2 cut(s) 102, 266
Hpy8I GTNNAC 2 cut(s) 175, 210
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 3 cut(s) 94, 136, 223
HpyF3I CTNAG 2 cut(s) 101, 198
Hsp92II CATG 1 cut(s) 94
KspAI GTTAAC 1 cut(s) 175
LpnPI CCDG 2 cut(s) 41, 172
LweI GCATC 1 cut(s) 157
MaeIII GTNAC 2 cut(s) 11, 240
MfeI CAATTG 1 cut(s) 36
MluCI AATT 3 cut(s) 36, 148, 224
MnlI CCTC 6 cut(s) 22, 96, 122, 183, 226, 229
MseI TTAA 2 cut(s) 174, 246
MspCI CTTAAG 1 cut(s) 245
MunI CAATTG 1 cut(s) 36
NlaIII CATG 1 cut(s) 94
PspFI CCCAGC 1 cut(s) 55
RsaI GTAC 1 cut(s) 209
RsaNI GTAC 1 cut(s) 208
SaqAI TTAA 2 cut(s) 174, 246
SetI ASST 1 cut(s) 114
SfaNI GCATC 1 cut(s) 157
SfcI CTRYAG 1 cut(s) 126
SgeI CNNG 6 cut(s) 21, 31, 68, 85, 103, 199
SmlI CTYRAG 1 cut(s) 245
SmoI CTYRAG 1 cut(s) 245
Sse9I AATT 3 cut(s) 36, 148, 224
TaaI ACNGT 1 cut(s) 118
TasI AATT 3 cut(s) 36, 148, 224
Tru1I TTAA 2 cut(s) 174, 246
Tru9I TTAA 2 cut(s) 174, 246
TscAI CASTG 1 cut(s) 121
TspRI CASTG 1 cut(s) 121
Vha464I CTTAAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.