RchiOBHm_Chr1g0327251

Belongs to the PdxS SNZ family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
15991583 .. 15993820
2238 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ55679

Sequence Viewer

Length: 171 bp
ATGTTCGAAGCACATGCTGTGACCCATTACAATGACCCGAATATACTTGCTGATGTGAGCTGTGGATTGGGTAAGGCTATGGTTGGACTGAATTTGAATGATGCCAAGGTCGAAAGGAATCAATTACATAAGCATTTAGGTAACACTGGACATGCTTCACTGAAGAAGTGA

Protein Analysis

56

Amino Acids

6.08

Weight (kDa)

7.98

Isoelectric Point (pI)

24.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 91
AgsI TTSAA 1 cut(s) 97
AluBI AGCT 1 cut(s) 60
AluI AGCT 1 cut(s) 60
ApoI RAATTY 1 cut(s) 91
AsuII TTCGAA 1 cut(s) 6
BcgI CGANNNNNNTGC 1 cut(s) 30
BmsI GCATC 1 cut(s) 91
Bpu14I TTCGAA 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 105
Bse1I ACTGG 1 cut(s) 151
BseDI CCNNGG 1 cut(s) 105
BseNI ACTGG 1 cut(s) 151
Bsp119I TTCGAA 1 cut(s) 6
BspT104I TTCGAA 1 cut(s) 6
BsrI ACTGG 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 105
BssT1I CCWWGG 1 cut(s) 105
BstBI TTCGAA 1 cut(s) 6
BstNSI RCATGY 2 cut(s) 17, 155
BtsIMutI CAGTG 2 cut(s) 144, 158
CviAII CATG 2 cut(s) 14, 152
CviJI RGCY 2 cut(s) 60, 77
CviKI_1 RGCY 2 cut(s) 60, 77
Eco130I CCWWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 105
ErhI CCWWGG 1 cut(s) 105
FaeI CATG 2 cut(s) 17, 155
FaiI YATR 5 cut(s) 15, 44, 80, 129, 153
FatI CATG 2 cut(s) 13, 151
Hin1II CATG 2 cut(s) 17, 155
HinfI GANTC 1 cut(s) 118
Hsp92II CATG 2 cut(s) 17, 155
LpnPI CCDG 1 cut(s) 132
LweI GCATC 1 cut(s) 91
MaeIII GTNAC 2 cut(s) 19, 140
MluCI AATT 2 cut(s) 91, 122
MmeI TCCRAC 1 cut(s) 64
MslI CAYNNNNRTG 1 cut(s) 30
NlaIII CATG 2 cut(s) 17, 155
NmuCI GTSAC 1 cut(s) 19
NspI RCATGY 2 cut(s) 17, 155
NspV TTCGAA 1 cut(s) 6
PfeI GAWTC 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 30
SetI ASST 3 cut(s) 62, 111, 142
SfaNI GCATC 1 cut(s) 91
SfuI TTCGAA 1 cut(s) 6
SgeI CNNG 6 cut(s) 26, 49, 59, 118, 159, 164
SmiMI CAYNNNNRTG 1 cut(s) 30
Sse9I AATT 2 cut(s) 91, 122
StyI CCWWGG 1 cut(s) 105
TaqI TCGA 2 cut(s) 6, 111
TasI AATT 2 cut(s) 91, 122
TfiI GAWTC 1 cut(s) 118
TscAI CASTG 2 cut(s) 151, 165
TseFI GTSAC 1 cut(s) 19
Tsp45I GTSAC 1 cut(s) 19
TspRI CASTG 2 cut(s) 151, 165
XapI RAATTY 1 cut(s) 91
XceI RCATGY 2 cut(s) 17, 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.