Rh5BG265000

Belongs to the PdxS SNZ family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
33167597 .. 33168769
1173 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG265000.1

Sequence Viewer

Length: 159 bp
ATGTTCGAAGCACATCGGGGCAGGGCGATTGTGCAGGCTGTGACCCATTACAATGACCCGAATATACTTGCTGATGTGACCTGTGGATTGGGTGAGGCTATGGTTGGACTGAATTTGAATGATGCCAAGGTCGAAAGGTTTGTGAATCATTCCAAATAA

Protein Analysis

52

Amino Acids

5.72

Weight (kDa)

6.23

Isoelectric Point (pI)

15.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 112
AgsI TTSAA 1 cut(s) 118
ApoI RAATTY 1 cut(s) 112
AsuHPI GGTGA 1 cut(s) 104
AsuII TTCGAA 1 cut(s) 6
BmsI GCATC 1 cut(s) 112
Bpu14I TTCGAA 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 126
BseDI CCNNGG 1 cut(s) 126
BsgI GTGCAG 1 cut(s) 53
Bsp119I TTCGAA 1 cut(s) 6
BspT104I TTCGAA 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 126
BssT1I CCWWGG 1 cut(s) 126
BstBI TTCGAA 1 cut(s) 6
BstC8I GCNNGC 1 cut(s) 36
Cac8I GCNNGC 1 cut(s) 36
CviJI RGCY 2 cut(s) 38, 98
CviKI_1 RGCY 2 cut(s) 38, 98
Eco130I CCWWGG 1 cut(s) 126
EcoT14I CCWWGG 1 cut(s) 126
ErhI CCWWGG 1 cut(s) 126
FaiI YATR 2 cut(s) 65, 101
HinfI GANTC 1 cut(s) 145
HphI GGTGA 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 34
LpnPI CCDG 3 cut(s) 7, 20, 94
LweI GCATC 1 cut(s) 112
MaeIII GTNAC 2 cut(s) 40, 76
MluCI AATT 1 cut(s) 112
MmeI TCCRAC 1 cut(s) 85
MnlI CCTC 1 cut(s) 88
MslI CAYNNNNRTG 1 cut(s) 51
NmuCI GTSAC 2 cut(s) 40, 76
NspV TTCGAA 1 cut(s) 6
PfeI GAWTC 1 cut(s) 145
RseI CAYNNNNRTG 1 cut(s) 51
SetI ASST 3 cut(s) 83, 132, 140
SfaNI GCATC 1 cut(s) 112
SfuI TTCGAA 1 cut(s) 6
SgeI CNNG 7 cut(s) 29, 34, 47, 70, 80, 93, 139
SmiMI CAYNNNNRTG 1 cut(s) 51
Sse9I AATT 1 cut(s) 112
StyI CCWWGG 1 cut(s) 126
TaqI TCGA 2 cut(s) 6, 132
TasI AATT 1 cut(s) 112
TfiI GAWTC 1 cut(s) 145
TseFI GTSAC 2 cut(s) 40, 76
Tsp45I GTSAC 2 cut(s) 40, 76
XapI RAATTY 1 cut(s) 112
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.